gnl2

Ensembl ID:
ENSDARG00000053225
ZFIN ID:
ZDB-GENE-040426-2317
Description:
guanine nucleotide binding protein-like 2 (nucleolar) [Source:RefSeq peptide;Acc:NP_998389]
Human Orthologue:
GNL2
Human Description:
guanine nucleotide binding protein-like 2 (nucleolar) [Source:HGNC Symbol;Acc:29925]
Mouse Orthologue:
Gnl2
Mouse Description:
guanine nucleotide binding protein-like 2 (nucleolar) Gene [Source:MGI Symbol;Acc:MGI:2385207]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9463 Nonsense Available for shipment Available now
sa8829 Nonsense Available for shipment Available now
sa36199 Nonsense Mutation detected in F1 DNA During 2016
sa36200 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9463
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075222 Nonsense 108 726 4 16
ENSDART00000125722 Nonsense 108 725 4 16
ENSDART00000130827   None 726 None 16
ENSDART00000134642   None 261 None 8
ENSDART00000075222 Nonsense 108 726 4 16
ENSDART00000125722 Nonsense 108 725 4 16
ENSDART00000130827   None 726 None 16
ENSDART00000134642   None 261 None 8

The following transcripts of ENSDARG00000053225 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 36210384)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 33951010
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTTGCAGAAGTTTCAGGAAGAAATGAAYGCGGTGAAGAAAGATCCATAC[C/T]GAGTGGTGATGAGACAGAGCAAACTACCAATGTCCTTGCTGCATGACCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8829
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075222 Nonsense 108 726 4 16
ENSDART00000125722 Nonsense 108 725 4 16
ENSDART00000130827   None 726 None 16
ENSDART00000134642   None 261 None 8
ENSDART00000075222 Nonsense 108 726 4 16
ENSDART00000125722 Nonsense 108 725 4 16
ENSDART00000130827   None 726 None 16
ENSDART00000134642   None 261 None 8

The following transcripts of ENSDARG00000053225 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 36210384)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 33951010
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTTGCAGAAGTTTCAGGAAGAAATGAAYGCGGTGAAGAAAGATCCATAC[C/T]GAGTGGTGATGAGACAGAGCAAACTACCAATGTCCTTGCTGCATGACCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36199
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075222   None 726 None 16
ENSDART00000125722 Nonsense 235 725 7 16
ENSDART00000130827   None 726 None 16
ENSDART00000134642   None 261 None 8

The following transcripts of ENSDARG00000053225 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 36217799)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 33956210
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGTAATTATCCAGGTGCTGGATGCTCGGGACCCAATGGGCACACGCTCA[C/T]AAAGCATTGAGACTTACTTGAAGAAAGAGAAGCCTTGGAAACACCTCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36200
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075222   None 726 None 16
ENSDART00000125722 Nonsense 240 725 7 16
ENSDART00000130827   None 726 None 16
ENSDART00000134642   None 261 None 8

The following transcripts of ENSDARG00000053225 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 36217816)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 33956227
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGATGCTCGGGACCCAATGGGCACACGCTCACAAAGCATTGAGACTTA[C/A]TTGAAGAAAGAGAAGCCTTGGAAACACCTCATATTTGTGCTCAATAAATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link