gnl2

Ensembl ID:
ENSDARG00000053225
ZFIN ID:
ZDB-GENE-040426-2317
Description:
guanine nucleotide binding protein-like 2 (nucleolar) [Source:RefSeq peptide;Acc:NP_998389]
Human Orthologue:
GNL2
Human Description:
guanine nucleotide binding protein-like 2 (nucleolar) [Source:HGNC Symbol;Acc:29925]
Mouse Orthologue:
Gnl2
Mouse Description:
guanine nucleotide binding protein-like 2 (nucleolar) Gene [Source:MGI Symbol;Acc:MGI:2385207]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9463 Nonsense Available for shipment Available now
sa8829 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9463
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075222 Nonsense 108 726 4 16
ENSDART00000125722 Nonsense 108 725 4 16
ENSDART00000130827 None None 726 None 16
ENSDART00000134642 None None 261 None 8
ENSDART00000075222 Nonsense 108 726 4 16
ENSDART00000125722 Nonsense 108 725 4 16
ENSDART00000130827 None None 726 None 16
ENSDART00000134642 None None 261 None 8

The following transcripts of ENSDARG00000053225 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 36210384)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTTGCAGAAGTTTCAGGAAGAAATGAAYGCGGTGAAGAAAGATCCATAC[C/T]GAGTGGTGATGAGACAGAGCAAACTACCAATGTCCTTGCTGCATGACCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8829
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075222 Nonsense 108 726 4 16
ENSDART00000125722 Nonsense 108 725 4 16
ENSDART00000130827 None None 726 None 16
ENSDART00000134642 None None 261 None 8
ENSDART00000075222 Nonsense 108 726 4 16
ENSDART00000125722 Nonsense 108 725 4 16
ENSDART00000130827 None None 726 None 16
ENSDART00000134642 None None 261 None 8

The following transcripts of ENSDARG00000053225 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 36210384)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTTGCAGAAGTTTCAGGAAGAAATGAAYGCGGTGAAGAAAGATCCATAC[C/T]GAGTGGTGATGAGACAGAGCAAACTACCAATGTCCTTGCTGCATGACCGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2a52ydbj