Q32PT0_DANRE

Ensembl ID:
ENSDARG00000053220
Description:
LOC566456 protein [Source:UniProtKB/TrEMBL;Acc:Q32PT0]
Human Orthologue:
UNC13C
Human Description:
unc-13 homolog C (C. elegans) [Source:HGNC Symbol;Acc:23149]
Mouse Orthologue:
Unc13c
Mouse Description:
unc-13 homolog C (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:2149021]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44379 Nonsense Mutation detected in F1 DNA During 2017
sa30353 Nonsense Mutation detected in F1 DNA During 2017
sa30352 Nonsense Mutation detected in F1 DNA During 2017
sa24749 Nonsense Mutation detected in F1 DNA During 2017
sa30351 Nonsense Mutation detected in F1 DNA During 2017
sa30350 Nonsense Mutation detected in F1 DNA During 2017
sa30349 Nonsense Mutation detected in F1 DNA During 2017
sa39504 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44379
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075229 Nonsense 90 414 2 2
ENSDART00000124494 Nonsense 90 1393 1 8
Genomic Location (Zv9):
Chromosome Zv9_scaffold3505 (position 94838)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 3726760
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATATATCTCTTGAAGAGGATGACGGCAAAACCGACTGTTCTTCTCTCT[C/A]GCCAACATTCAGTTACCGCGTAGCAATTGCCAACGGACTGCCCAAAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30353
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075229 Nonsense 300 414 2 2
ENSDART00000124494 Nonsense 300 1393 1 8
Genomic Location (Zv9):
Chromosome Zv9_scaffold3505 (position 94209)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 3726131
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTGGTGCAGAGTGAAATCGAGCAGCTCCGTTCAGGTTTCGTGCAGTCC[A/T]GACGCGAGACTCGAGACATTCATGATTACATCCGACAGATCAGCCAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30352
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075229   None 414 None 2
ENSDART00000124494 Nonsense 814 1393 1 8
Genomic Location (Zv9):
Chromosome Zv9_scaffold3505 (position 92667)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 3724589
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAGAAGCCTAAAACCAAGAAGATCCAAGCTAAACCTGAATCAGCTCCA[C/T]AAACTTTGCAGCGACAAGATGTGAACCACCACCTCCAGCAGAACCAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24749
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075229   None 414 None 2
ENSDART00000124494 Nonsense 872 1393 1 8
Genomic Location (Zv9):
Chromosome Zv9_scaffold3505 (position 92493)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 3724415
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGGCTCAGCATCGACCTCAGCGAGAAAACCTTCGGCTTTGGGGGATTT[G/T]GATCCACCCTGCAAAGAGCAAAGTCAGCTTTGGATTTTGTGTGGAATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30351
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075229   None 414 None 2
ENSDART00000124494 Nonsense 977 1393 1 8
Genomic Location (Zv9):
Chromosome Zv9_scaffold3505 (position 92178)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 3724100
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAACAAGTGCTAGCCAATCTGGAAAACAGAACAAACGCAAACGAACCC[G/T]AGGAACAGTACCAAGAAGAGGAATACAATGTCTCACAGGAGTATGATCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30350
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075229   None 414 None 2
ENSDART00000124494 Nonsense 1019 1393 1 8
Genomic Location (Zv9):
Chromosome Zv9_scaffold3505 (position 92050)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 3723972
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGATTGCAGCCTCGATGAACAGTATGATGAGGAATACAGTGAGGACTA[C/A]GATGACAATCCTATGACTGAAGACACAGCAGAATATGAGGTTAGTTTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30349
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075229   None 414 None 2
ENSDART00000124494 Nonsense 1076 1393 1 8
Genomic Location (Zv9):
Chromosome Zv9_scaffold3505 (position 91881)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 3723803
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCGGGAGGTTCAGGAAACATCTGAAATTAAAGGAGAAGATGTGGTAAAA[G/T]AGACCGTAGAGCAAGAGGATGAGAATAAAAATGTTACAGAGGTTCCTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39504
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075229   None 414 None 2
ENSDART00000124494 Nonsense 1281 1393 7 8
Genomic Location (Zv9):
Chromosome Zv9_scaffold3505 (position 29807)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 3661729
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCATCATCCTCTACAGGTGCAGTAGAGAAGAGCTCGAAACACGGAGCC[G/T]AGGACAAAACCCAGAACATCATCATGGCCATGAAGGAGCGCATGAAGATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link