me1

Ensembl ID:
ENSDARG00000053215
ZFIN ID:
ZDB-GENE-061013-438
Description:
cytosolic malic enzyme 1 [Source:RefSeq peptide;Acc:NP_001070806]
Human Orthologue:
ME1
Human Description:
malic enzyme 1, NADP(+)-dependent, cytosolic [Source:HGNC Symbol;Acc:6983]
Mouse Orthologue:
Me1
Mouse Description:
malic enzyme 1, NADP(+)-dependent, cytosolic Gene [Source:MGI Symbol;Acc:MGI:97043]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3977 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3977
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075218 None None 442 None 15
ENSDART00000101969 Essential Splice Site 39 584 1 14
ENSDART00000110572 Essential Splice Site 29 574 1 14
ENSDART00000147941 None None 585 None 14
Genomic Location:
Chromosome 16 (position 35290264)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACAAAGAAGCGGGGGTATGATGTTACACGCAACCCCCATCTGAATAAG[G/A]TAAAAAGGARATGTTTTAWAAACTTTTAAAAAATAATCTTCTGTTGACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hus78wcs