me1

Ensembl ID:
ENSDARG00000053215
ZFIN ID:
ZDB-GENE-061013-438
Description:
cytosolic malic enzyme 1 [Source:RefSeq peptide;Acc:NP_001070806]
Human Orthologue:
ME1
Human Description:
malic enzyme 1, NADP(+)-dependent, cytosolic [Source:HGNC Symbol;Acc:6983]
Mouse Orthologue:
Me1
Mouse Description:
malic enzyme 1, NADP(+)-dependent, cytosolic Gene [Source:MGI Symbol;Acc:MGI:97043]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39116 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa39116
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075218 Nonsense 42 442 2 15
ENSDART00000101969 Nonsense 82 584 2 14
ENSDART00000110572 Nonsense 72 574 2 14
ENSDART00000147941 Nonsense 83 585 2 14
Genomic Location (Zv9):
Chromosome 16 (position 35243965)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32975465
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGCAAGTTTTGCGGGTCCTTAGGAGCTACGAGCTGTTAAAGGAAGATT[T/A]GGACAGGTGAGAAAACAGACTACTGATGATCTATATGACTTTCAGAATTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link