psd3l

Ensembl ID:
ENSDARG00000053210
ZFIN ID:
ZDB-GENE-030131-8195
Human Orthologue:
PSD3
Human Description:
pleckstrin and Sec7 domain containing 3 [Source:HGNC Symbol;Acc:19093]
Mouse Orthologue:
Psd3
Mouse Description:
pleckstrin and Sec7 domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1918215]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21644 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21644
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075211 Nonsense 238 859 2 14
ENSDART00000145864 Nonsense 238 859 3 15

The following transcripts of ENSDARG00000053210 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 5655864)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 7099031
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGGTAAATCTGCTGCAGGTGAGATTGACACCACAGATGTCTTCAGCTG[T/A]CAGTTTGAGAACATCCTGGAGTCGGAGCGTCTGCGAGGGACTCTCTACAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
  • Platelet counts: Duffy-null-associated low neutrophil counts influence HIV-1 susceptibility in high-risk South African black women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link