ppfia4

Ensembl ID:
ENSDARG00000053205
ZFIN ID:
ZDB-GENE-070720-14
Description:
PTPRF interacting protein alpha 2 [Source:RefSeq peptide;Acc:NP_001093621]
Human Orthologue:
PPFIA4
Human Description:
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), al
Mouse Orthologue:
Ppfia4
Mouse Description:
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), al

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41821 Nonsense Mutation detected in F1 DNA During 2017
sa41822 Nonsense Mutation detected in F1 DNA During 2017
sa35073 Essential Splice Site Available for shipment Available now
sa41823 Nonsense Mutation detected in F1 DNA During 2017
sa27773 Essential Splice Site Mutation detected in F1 DNA During 2017
sa1878 Essential Splice Site Available for shipment Available now
sa11854 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41821
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090182 Nonsense 153 1174 4 29
ENSDART00000112567 Nonsense 190 1211 4 29
Genomic Location (Zv9):
Chromosome 11 (position 23331027)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 22337258
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCGTGAAAGGTTGCGTGTGGCTCTTGAAAGGGTGACTACATTAGAAGGA[C/T]AGCTGTCAGCCGCCACTCAGGAGGTACAGCTCTATTGTGCTTGCGTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41822
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090182 Nonsense 459 1174 12 29
ENSDART00000112567 Nonsense 496 1211 12 29
Genomic Location (Zv9):
Chromosome 11 (position 23363777)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 22370008
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGTGATTTCTGTCTATGTAGGAGAGACTCATTGGGGAGATTGAGAAGT[T/A]AAGGGCTGAACTCGATCATCTGAAGCGCAGAAGTGGAGCATTTGGAGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35073
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090182 Essential Splice Site 524 1174 13 29
ENSDART00000112567 Essential Splice Site 561 1211 13 29
Genomic Location (Zv9):
Chromosome 11 (position 23364476)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 22370707
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACGTGCTCAGAAAGGTCGAATGGTGGCACTCAGGGATGAACCAACCAAG[G/T]TGAAAATGTCACACATACAGCACTTCTCCATCCATCACCGTCTTATGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41823
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090182 Nonsense 591 1174 14 29
ENSDART00000112567 Nonsense 628 1211 14 29
Genomic Location (Zv9):
Chromosome 11 (position 23368715)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 22374946
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCCAGCGGGCACTCAGACGCCCAGACGCTTGCCCTCATGCTCCAAGAA[C/T]AGCTGGATGCCATCAATGAGGAGATCAGGTTGGGAATAATAATATGGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27773
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090182 Essential Splice Site 690 1174 16 29
ENSDART00000112567 Essential Splice Site 727 1211 16 29
Genomic Location (Zv9):
Chromosome 11 (position 23382574)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 22388805
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTCAGCCTAGTGATTTAAGGAAACACCGCAGGAGAGTGGCTGTAAGTG[T/C]GGCTTCATCTCTAAATGTCTTCACTGAACAACGGTTTATTTGTACTATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1878
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090182 Essential Splice Site 984 1174 25 29
ENSDART00000112567 Essential Splice Site 1021 1211 25 29
Genomic Location (Zv9):
Chromosome 11 (position 23406028)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 22412259
KASP Assay ID:
554-1868.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACACACACTTTAAACATGACCTACAATACTACATTCATTATGTCTTAC[A/T]GGGCTAGTTTGCACTATGGCATCATGTGCTTGAAAAGGCTAAACTATGAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa11854
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090182 Nonsense 999 1174 25 29
ENSDART00000112567 Nonsense 1036 1211 25 29
Genomic Location (Zv9):
Chromosome 11 (position 23406075)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 22412306
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACWGGGCTAGTTTGCACTATGGCATCATGTGCTTGAAAAGGCTAAACTA[T/G]GACCGGAAGGAGCTGGAGCGAAGGAGAGAGGATTTCCAGCATGATATCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link