dis3l

Ensembl ID:
ENSDARG00000053200
ZFIN ID:
ZDB-GENE-070209-95
Description:
DIS3-like exonuclease 1 [Source:UniProtKB/Swiss-Prot;Acc:A2RV18]
Human Orthologue:
DIS3L
Human Description:
DIS3 mitotic control homolog (S. cerevisiae)-like [Source:HGNC Symbol;Acc:28698]
Mouse Orthologue:
Dis3l
Mouse Description:
DIS3 mitotic control homolog (S. cerevisiae)-like Gene [Source:MGI Symbol;Acc:MGI:2143272]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20997 Nonsense Available for shipment Available now
sa12925 Nonsense Available for shipment Available now
sa10294 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20997
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075176 Nonsense 120 1057 3 17
Genomic Location (Zv9):
Chromosome 7 (position 35597389)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 33983004
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTGAAGGATCCTCGTCACGATTGTGTGCTCTTTGCCAATGAGTTTCAG[C/T]AATACTCCTACTGCCCCAGAGAAAAGGGTGAGTCCCAGGACAAATGGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12925
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075176 Nonsense 281 1057 7 17
Genomic Location (Zv9):
Chromosome 7 (position 35594726)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 33980341
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCAGAGCKCAACAGTGATGTGCTAATCAATGGYGCAAAACATCGCAAT[C/T]GAGCCGTGCAYGGAGATGTGGTTGTCATTGAGCTGTTKCCCCGTAATGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10294
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075176 Nonsense 586 1057 12 17
Genomic Location (Zv9):
Chromosome 7 (position 35589906)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 33975521
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGTCTGGTTTGGCCGTACTCTCATCCGCTCCTCGTATCAGCTTCACTAT[G/T]AGCTGGCCCAGAGCCTGCTGAATGGGGAGGAGGTTGAGGTACCTGAGCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link