mtor

Ensembl ID:
ENSDARG00000053196
ZFIN ID:
ZDB-GENE-030131-2974
Description:
serine/threonine-protein kinase mTOR [Source:RefSeq peptide;Acc:NP_001070679]
Human Orthologue:
MTOR
Human Description:
mechanistic target of rapamycin (serine/threonine kinase) [Source:HGNC Symbol;Acc:3942]
Mouse Orthologue:
Mtor
Mouse Description:
mechanistic target of rapamycin (serine/threonine kinase) Gene [Source:MGI Symbol;Acc:MGI:1928394]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21374 Essential Splice Site Available for shipment Available now
sa16755 Nonsense Available for shipment Available now
sa8325 Nonsense Mutation detected in F1 DNA During 2014
sa11792 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21374
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075189 Essential Splice Site 910 2515 18 58
ENSDART00000122801 Essential Splice Site 910 2563 18 58
Genomic Location:
Chromosome 8 (position 48429356)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGCTTCTGCCGTCAGCCTCTCCGAGTCCAAGTCCAGCCAGGATTCAGG[T/C]AATCAGATGCACCCGCTAACGAAAGCTCGCATCAACACAATTACTCACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16755
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075189 Nonsense 930 2515 19 58
ENSDART00000122801 Nonsense 930 2563 19 58
Genomic Location:
Chromosome 8 (position 48419091)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCAGCGAGATGCTGGTCAACATGGGCAACCTGCCGCTAGACGARTTTTA[C/A]CCAGCAGTCGCCATAGTGACCCTGATGCGTATCCTGCGTGACCCGTCKCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8325
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075189 Nonsense 2162 2515 47 58
ENSDART00000122801 Nonsense 2162 2563 47 58
Genomic Location:
Chromosome 8 (position 48259701)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCATGAGTTCATGTTCCTGCTGAAGGGTCATGAAGATTTACGACAGGAC[G/T]AGAGGGTCATGCAGCTTTTTGGCTTGGTGAACACTCTACTGGCTAATGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11792
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075189 Nonsense 2435 2515 55 58
ENSDART00000122801 Nonsense 2483 2563 55 58
Genomic Location:
Chromosome 8 (position 48242917)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTCGTGTAGAAGCCATGGAGGGTATTGACCTGGGAGAAACAACGCAC[A/T]ARAAGCCTGGAACTACMGTGCCTGAGTCCATTCACTCTTTCAGTAAGTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ragkggxz