mtor

Ensembl ID:
ENSDARG00000053196
ZFIN ID:
ZDB-GENE-030131-2974
Description:
serine/threonine-protein kinase mTOR [Source:RefSeq peptide;Acc:NP_001070679]
Human Orthologue:
MTOR
Human Description:
mechanistic target of rapamycin (serine/threonine kinase) [Source:HGNC Symbol;Acc:3942]
Mouse Orthologue:
Mtor
Mouse Description:
mechanistic target of rapamycin (serine/threonine kinase) Gene [Source:MGI Symbol;Acc:MGI:1928394]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38710 Nonsense Mutation detected in F1 DNA During 2016
sa21374 Essential Splice Site Available for shipment Available now
sa16755 Nonsense Available for shipment Available now
sa34485 Essential Splice Site Mutation detected in F1 DNA During 2016
sa31678 Nonsense Mutation detected in F1 DNA During 2016
sa30906 Essential Splice Site Mutation detected in F1 DNA During 2016
sa8325 Nonsense Mutation detected in F1 DNA During 2016
sa41292 Nonsense Mutation detected in F1 DNA During 2016
sa11792 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38710
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075189 Nonsense 420 2515 9 58
ENSDART00000122801 Nonsense 420 2563 9 58
Genomic Location:
Chromosome 8 (position 48456484)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCACCTGCTGGGCTGCCTAAAAAAAGAAAAGGAGCGGACGGCAGCATTT[C/T]AAGCGCTGGGGCTACTGGTGGTGGCTGTGAGGGCTGATATTCAGCCATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21374
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075189 Essential Splice Site 910 2515 18 58
ENSDART00000122801 Essential Splice Site 910 2563 18 58
Genomic Location:
Chromosome 8 (position 48429356)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGCTTCTGCCGTCAGCCTCTCCGAGTCCAAGTCCAGCCAGGATTCAGG[T/C]AATCAGATGCACCCGCTAACGAAAGCTCGCATCAACACAATTACTCACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16755
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075189 Nonsense 930 2515 19 58
ENSDART00000122801 Nonsense 930 2563 19 58
Genomic Location:
Chromosome 8 (position 48419091)
KASP Assay ID:
2260-1081.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCAGCGAGATGCTGGTCAACATGGGCAACCTGCCGCTAGACGARTTTTA[C/A]CCAGCAGTCGCCATAGTGACCCTGATGCGTATCCTGCGTGACCCGTCKCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34485
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075189 Essential Splice Site 1170 2515 23 58
ENSDART00000122801 Essential Splice Site 1170 2563 23 58
Genomic Location:
Chromosome 8 (position 48397798)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCCTCCATGGACACACTGTCCTCGCTGGTCTTCCAGCTTGGTAAAAAG[G/A]TACAAGCTCTAAATCTACCCCAAGTCTGTCCAATAGTTATAGTTGCGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31678
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075189 Nonsense 1266 2515 26 58
ENSDART00000122801 Nonsense 1266 2563 26 58
Genomic Location:
Chromosome 8 (position 48387508)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGCATGGGGTGCAGCCAGAAAGGTGTCCAAAGATGACTGGCTGGAGTG[G/A]TTGAGACGACTTAGTGTGGTCTTGCTAAAGGAATCCTCCTCACCAGCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30906
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075189 Essential Splice Site 2038 2515 44 58
ENSDART00000122801 Essential Splice Site 2038 2563 44 58
Genomic Location:
Chromosome 8 (position 48268031)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATGATGGAGAGAGGACCACAAACCCTAAAAGAAACATCATTTAATCAG[G/A]TAAAAACGCTCATAACTCACTGTAAAGTCGAATTCCGTATGTAAGAGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8325
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075189 Nonsense 2162 2515 47 58
ENSDART00000122801 Nonsense 2162 2563 47 58
Genomic Location:
Chromosome 8 (position 48259701)
KASP Assay ID:
2260-1078.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCATGAGTTCATGTTCCTGCTGAAGGGTCATGAAGATTTACGACAGGAC[G/T]AGAGGGTCATGCAGCTTTTTGGCTTGGTGAACACTCTACTGGCTAATGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41292
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075189 Nonsense 2221 2515 48 58
ENSDART00000122801 Nonsense 2245 2563 48 58
Genomic Location:
Chromosome 8 (position 48253069)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGGGTTCCTCACTGTGACACGCTGCACGCACTGATTCGAGACTACAGA[G/T]AGAAGAAGAAGATCCTGCTCAACATTGAACATCGCATCATGCTCAGGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11792
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075189 Nonsense 2435 2515 55 58
ENSDART00000122801 Nonsense 2483 2563 55 58
Genomic Location:
Chromosome 8 (position 48242917)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTCGTGTAGAAGCCATGGAGGGTATTGACCTGGGAGAAACAACGCAC[A/T]ARAAGCCTGGAACTACMGTGCCTGAGTCCATTCACTCTTTCAGTAAGTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link