sc:d805

Ensembl ID:
ENSDARG00000053186
ZFIN ID:
ZDB-GENE-080303-17
Description:
cDNA, clone cssl:d0805 [Source:UniProtKB/TrEMBL;Acc:A4JYE7]
Human Orthologue:
C10orf72
Human Description:
chromosome 10 open reading frame 72 [Source:HGNC Symbol;Acc:26470]
Mouse Orthologue:
E130203B14Rik
Mouse Description:
RIKEN cDNA E130203B14 gene Gene [Source:MGI Symbol;Acc:MGI:2444633]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6227 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6227
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075179 Nonsense 151 319 2 9
Genomic Location (Zv9):
Chromosome 12 (position 2669370)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 2369878
KASP Assay ID:
554-4782.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCAGGAGCGATGGAAAGCTTCCACCAACAGCTCGGCCTCCACGCAGCTC[A/T]GAGGTTTGTCTACACAGCGCTAAACGAAGCTTTATGTATCTTTAAGTCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link