TSPAN17

Ensembl ID:
ENSDARG00000053183
Description:
tetraspanin 17 [Source:HGNC Symbol;Acc:13594]
Human Orthologue:
TSPAN17
Human Description:
tetraspanin 17 [Source:HGNC Symbol;Acc:13594]
Mouse Orthologue:
Tspan17
Mouse Description:
tetraspanin 17 Gene [Source:MGI Symbol;Acc:MGI:1921507]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35766 Essential Splice Site Mutation detected in F1 DNA During 2016
sa5873 Essential Splice Site Mutation detected in F1 DNA During 2016
sa35767 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa35766
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101132 Essential Splice Site 24 209 2 8
Genomic Location (Zv9):
Chromosome 14 (position 51923284)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149930.1 60148
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATTAATAATCGAAAGAATAAGTTAAGAAGAAATTCCTAATTACACTTA[T/C]CAACGGCCACTTTATTAGGTACACCTTACTAGTAAGGGGTTGGATCCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5873
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101132 Essential Splice Site 35 209 3 8
Genomic Location (Zv9):
Chromosome 14 (position 51923615)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149930.1 60479
KASP Assay ID:
554-3802.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATGGTCAGCAACAAAAATTTCATTTTTTGGGAGAACCATCCCTTTAAT[G/T]AGCTGCTGGTRAAAATGTCAAACAATCAAAGATCACAGATTTTAGACKAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35767
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101132 Nonsense 119 209 6 8
Genomic Location (Zv9):
Chromosome 14 (position 51926485)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149930.1 63349
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTTCCTGGAGCTCACTGCTGGCATTTTAGCCTTCGTCTTTAAAGACTG[G/A]ATCAAAGACCAGCTGAACTTCTTCATCAACAACAATGTTAAAGCATATCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link