CTTNBP2NL (2 of 2)

Ensembl ID:
ENSDARG00000053179
Description:
CTTNBP2 N-terminal like [Source:HGNC Symbol;Acc:25330]
Human Orthologue:
CTTNBP2NL
Human Description:
CTTNBP2 N-terminal like [Source:HGNC Symbol;Acc:25330]
Mouse Orthologue:
Cttnbp2nl
Mouse Description:
CTTNBP2 N-terminal like Gene [Source:MGI Symbol;Acc:MGI:1933137]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18209 Nonsense Available for shipment Available now
sa18852 Nonsense Mutation detected in F1 DNA During 2014
sa3601 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18209
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075172 Nonsense 11 439 1 4
Genomic Location:
Chromosome 6 (position 48178847)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCYCTCTTCTTTCACTATAGRCCCAGCATAAAGATTCATACGTGTGTGAA[C/T]GATACGGAAAATACAACCTGAGTGACCCGTTCYTGGCCCTGCARAGAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18852
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075172 Nonsense 408 439 4 4
ENSDART00000075172 Nonsense 408 439 4 4
Genomic Location:
Chromosome 6 (position 48182459)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCCAAAAAACCAGGCCTGGCCGAAACGCCGCCTTCTCCTGCCACCCTG[C/T]GAGCTGCTCACTTTGCTCATATGACTGTCGGTTGCGGACGCAACAGCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3601
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075172 Nonsense 408 439 4 4
ENSDART00000075172 Nonsense 408 439 4 4
Genomic Location:
Chromosome 6 (position 48182459)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACCCAAAAAACCAGGCCTGGCCGAAACKCCGCCTTCTCCTGCCACCCTG[C/T]GAGCTGCTCACKTTGCTCAWATGACTGTCGGTTGCGGACGCAACAGCAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zhx9ds0e