alg3

Ensembl ID:
ENSDARG00000053155
ZFIN ID:
ZDB-GENE-050522-334
Description:
dolichyl-P-Man:Man(5)GlcNAc(2)-PP-dolichyl mannosyltransferase [Source:RefSeq peptide;Acc:NP_001018
Human Orthologue:
ALG3
Human Description:
asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae) [Source:HG
Mouse Orthologue:
Alg3
Mouse Description:
asparagine-linked glycosylation 3 homolog (yeast, alpha-1,3-mannosyltransferase) Gene [Source:MGI Sy

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6860 Essential Splice Site Mutation detected in F1 DNA During 2014
sa3397 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6860
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075146 Essential Splice Site 331 434 8 9
ENSDART00000144024 Essential Splice Site 95 151 3 4
Genomic Location:
Chromosome 2 (position 45040114)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTWATTYTKARCTTATATGACTATAAACGGYTCCTTAACCCAGATTGTA[C/T]AGATGGTTCTTATTCTGTTTACATCWAACTTCATTGGCATGTGCTTCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3397
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075146 Essential Splice Site 379 434 8 9
ENSDART00000144024 Essential Splice Site 143 151 3 4
Genomic Location:
Chromosome 2 (position 45040261)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTACCTGCTGTGGAGTGGAGGAGTGAAGAAGCTGGCACACCTACTCAGG[T/G]AAAACATATCTCAATATTTAGATAACACTGTAGTGKACAGTCAGTCTAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tk2sei9i