alg3

Ensembl ID:
ENSDARG00000053155
ZFIN ID:
ZDB-GENE-050522-334
Description:
dolichyl-P-Man:Man(5)GlcNAc(2)-PP-dolichyl mannosyltransferase [Source:RefSeq peptide;Acc:NP_001018
Human Orthologue:
ALG3
Human Description:
asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae) [Source:HG
Mouse Orthologue:
Alg3
Mouse Description:
asparagine-linked glycosylation 3 homolog (yeast, alpha-1,3-mannosyltransferase) Gene [Source:MGI Sy

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6860 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa6860
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075146 Essential Splice Site 331 434 8 9
ENSDART00000144024 Essential Splice Site 95 151 3 4
Genomic Location (Zv9):
Chromosome 2 (position 45040114)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 45125615
KASP Assay ID:
554-4421.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTWATTYTKARCTTATATGACTATAAACGGYTCCTTAACCCAGATTGTA[C/T]AGATGGTTCTTATTCTGTTTACATCWAACTTCATTGGCATGTGCTTCAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link