b2m

Ensembl ID:
ENSDARG00000053136
ZFIN ID:
ZDB-GENE-980526-88
Description:
Beta-2-microglobulin [Source:UniProtKB/Swiss-Prot;Acc:Q04475]
Human Orthologue:
B2M
Human Description:
beta-2-microglobulin [Source:HGNC Symbol;Acc:914]
Mouse Orthologue:
B2m
Mouse Description:
beta-2 microglobulin Gene [Source:MGI Symbol;Acc:MGI:88127]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33421 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33421
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075127 Essential Splice Site 22 116 None 4
ENSDART00000131026 Essential Splice Site 22 116 None 3
Genomic Location (Zv9):
Chromosome 4 (position 11859849)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 12796476
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTTTGCACTTCTTTGTCTGCTGTACATCACTGTACAGGGGAAAGTCTG[T/A]AAGTCATTTAGATTGCATATCTGAATTCTGTTTTTTGTTCTGTTTTTTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link