tas1r2.1

Ensembl ID:
ENSDARG00000053135
ZFIN ID:
ZDB-GENE-070917-1
Description:
taste receptor, type 1, member 2.1 [Source:RefSeq peptide;Acc:NP_001034920]
Human Orthologue:
TAS1R2
Human Description:
taste receptor, type 1, member 2 [Source:HGNC Symbol;Acc:14905]
Mouse Orthologue:
Tas1r2
Mouse Description:
taste receptor, type 1, member 2 Gene [Source:MGI Symbol;Acc:MGI:1933546]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12214 Essential Splice Site Available for shipment Available now
sa3687 Nonsense Mutation detected in F1 DNA During 2014
sa21376 Nonsense Mutation detected in F1 DNA During 2014
sa2477 Nonsense Mutation detected in F1 DNA During 2014
sa18930 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12214
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075125 Essential Splice Site 160 825 2 6
Genomic Location:
Chromosome 8 (position 48742033)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGGACTATTTCAATAGCACCACTGATCACAATGGACCTTATACCRTTGG[T/C]AAATCTTGTACARTTTACNNATATACAAMATGCTAAATWAATMATTTTWA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3687
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075125 Nonsense 282 825 3 6
Genomic Location:
Chromosome 8 (position 48742468)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCCACAATATGCAGTCARCATAATCAATACTGCCATAGCGGACAACATC[C/T]GAGACAAAGTATGGATTGCGAGTGAAACCTGGTCTATGAATCAACAGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21376
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075125 Nonsense 292 825 3 6
Genomic Location:
Chromosome 8 (position 48742500)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCATAGCGGACAACATCCGAGACAAAGTATGGATTGCGAGTGAAACCTG[G/A]TCTATGAATCAACAGCTTCCAAGGGAGCCAGGAGTTGAGAAAATCGGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2477
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075125 Nonsense 818 825 6 6
ENSDART00000075125 Nonsense 818 825 6 6
Genomic Location:
Chromosome 8 (position 48751590)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCCACAGAAGAACACTGCTGCATACTTTCAGACATCTATTCAAAATTA[C/A]ACTCAAACCATTAGTAGGTCTTAGACCAAACATTCTGTAWGCAAATAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18930
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075125 Nonsense 818 825 6 6
ENSDART00000075125 Nonsense 818 825 6 6
Genomic Location:
Chromosome 8 (position 48751590)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCCACAGAAGAACACTGCTGCATACTTTCAGACATCTATTCAAAATTA[C/A]ACTCAAACCATTAGTAGGTCTTAGACCAAACATTCTGTATGCAAATAAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Parkinson's disease: Genome-wide association study confirms SNPs in SNCA and the MAPT region as common risk factors for Parkinson disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/slktbq7a