helb

Ensembl ID:
ENSDARG00000053127
ZFIN ID:
ZDB-GENE-030729-16
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0UYS3]
Human Orthologue:
HELB
Human Description:
helicase (DNA) B [Source:HGNC Symbol;Acc:17196]
Mouse Orthologue:
Helb
Mouse Description:
helicase (DNA) B Gene [Source:MGI Symbol;Acc:MGI:2152895]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20235 Nonsense Mutation detected in F1 DNA During 2015
sa15508 Nonsense Available for shipment Available now
sa30607 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa20235
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058020 Nonsense 663 1176 5 13

The following transcripts of ENSDARG00000053127 do not overlap with this mutation:

Genomic Location:
Chromosome 4 (position 11839403)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTCTTAGCATGCTTACCAAACACGCACAACTCCAGAAGTTCATCATTT[T/A]GGGTATAGACATAATTCATGTAGTTCTGTAGTATTCTGTAGATCATACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15508
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058020 Nonsense 721 1176 7 13

The following transcripts of ENSDARG00000053127 do not overlap with this mutation:

Genomic Location:
Chromosome 4 (position 11839019)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTATTTTCATAATCTTTTAGCATCTCTGAGATGGGYAAAAAAAAGTATTA[C/A]AAGCCTCTGGACTTTGATGCCAYCATAGACATGACAAACCCCTCTGCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30607
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058020 Nonsense 891 1176 11 13

The following transcripts of ENSDARG00000053127 do not overlap with this mutation:

Genomic Location:
Chromosome 4 (position 11837405)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAGGATGTGACTAAATCTGTCGAGAATGAAAAAAATAAAATGGTGCGT[C/T]AACTGACACTCGATGATAAAAGCGACCGCCAGGTGACTTGTAACTACAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/attamykz