helb

Ensembl ID:
ENSDARG00000053127
ZFIN ID:
ZDB-GENE-030729-16
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0UYS3]
Human Orthologue:
HELB
Human Description:
helicase (DNA) B [Source:HGNC Symbol;Acc:17196]
Mouse Orthologue:
Helb
Mouse Description:
helicase (DNA) B Gene [Source:MGI Symbol;Acc:MGI:2152895]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20235 Nonsense Mutation detected in F1 DNA During 2014
sa15508 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20235
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058020 Nonsense 663 1176 5 13

The following transcripts of ENSDARG00000053127 do not overlap with this mutation:

Genomic Location:
Chromosome 4 (position 11839403)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTCTTAGCATGCTTACCAAACACGCACAACTCCAGAAGTTCATCATTT[T/A]GGGTATAGACATAATTCATGTAGTTCTGTAGTATTCTGTAGATCATACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15508
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058020 Nonsense 721 1176 7 13

The following transcripts of ENSDARG00000053127 do not overlap with this mutation:

Genomic Location:
Chromosome 4 (position 11839019)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTATTTTCATAATCTTTTAGCATCTCTGAGATGGGYAAAAAAAAGTATTA[C/A]AAGCCTCTGGACTTTGATGCCAYCATAGACATGACAAACCCCTCTGCAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/attamykz