clvs2

Ensembl ID:
ENSDARG00000053122
ZFIN ID:
ZDB-GENE-041014-313
Description:
Clavesin-2 [Source:UniProtKB/Swiss-Prot;Acc:Q5SPP0]
Human Orthologue:
CLVS2
Human Description:
clavesin 2 [Source:HGNC Symbol;Acc:23046]
Mouse Orthologue:
Clvs2
Mouse Description:
clavesin 2 Gene [Source:MGI Symbol;Acc:MGI:2443223]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43508 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43508
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075112 Essential Splice Site 225 329 3 5
Genomic Location (Zv9):
Chromosome 20 (position 40314944)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 40386103
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTGTACACAGTCATCCGACCTTTTCTCAAGGACAAAACAAGAAAAAGG[G/A]TGAGACATTTTTAACATTTTAATCACGATTTTCTTTGATCACTGGTATAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link