fam102ba

Ensembl ID:
ENSDARG00000053104
ZFIN ID:
ZDB-GENE-060616-312
Description:
hypothetical protein LOC724011 [Source:RefSeq peptide;Acc:NP_001038781]
Human Orthologue:
FAM102B
Human Description:
family with sequence similarity 102, member B [Source:HGNC Symbol;Acc:27637]
Mouse Orthologue:
Fam102b
Mouse Description:
family with sequence similarity 102, member B Gene [Source:MGI Symbol;Acc:MGI:3036259]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3420 Essential Splice Site Mutation detected in F1 DNA During 2014
sa10391 Essential Splice Site Available for shipment Available now
sa17182 Essential Splice Site Available for shipment Available now
sa19865 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3420
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125406 Essential Splice Site 49 366 None 11

The following transcripts of ENSDARG00000053104 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 45746162)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGCAAGGTCCGACTGACGGACGGAGGCTTTTCAGAGGAGTCTTCGAGG[T/C]GAGACAAACTAACTTAAAGTCATCAATTGTTTTATATTAAAATGAAACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10391
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125406 Essential Splice Site 189 366 None 11
ENSDART00000125406 Essential Splice Site 189 366 None 11

The following transcripts of ENSDARG00000053104 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 45731273)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGAAGACAGAAGAGGAGAGACACCAAAAACAACCAATTACTTTACAGG[T/C]ATAAAGCATAGAAAGTRTAGAACACTACCACCTAAATACAGTCCTCAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17182
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125406 Essential Splice Site 189 366 None 11
ENSDART00000125406 Essential Splice Site 189 366 None 11

The following transcripts of ENSDARG00000053104 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 45731273)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGAAGACAGAAGAGGAGAGACACCAAAAACAACCAATTACTTTACAGG[T/A]ATAAAGCATAGAAAGTRTAGAACACTACCACCTAAATACAGTCCTCAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19865
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125406 Nonsense 211 366 7 11

The following transcripts of ENSDARG00000053104 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 45728661)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCTTTAGTCATGGTTCGGTTCCAGATGAACTGGGAAAGTGTGGCCACT[C/A]AAGAACCGCGAGCTACGCCAGCCAGCAGTCTAAGTTTTCAGGTGTGTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/68u0z9yx