prpf38b

Ensembl ID:
ENSDARG00000053101
ZFIN ID:
ZDB-GENE-040426-2878
Description:
Pre-mRNA-splicing factor 38B [Source:UniProtKB/Swiss-Prot;Acc:Q6P7Y3]
Human Orthologue:
PRPF38B
Human Description:
PRP38 pre-mRNA processing factor 38 (yeast) domain containing B [Source:HGNC Symbol;Acc:25512]
Mouse Orthologue:
Prpf38b
Mouse Description:
PRP38 pre-mRNA processing factor 38 (yeast) domain containing B Gene [Source:MGI Symbol;Acc:MGI:1914

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39927 Nonsense Mutation detected in F1 DNA During 2017
sa9573 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39927
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075080 Nonsense 56 501 1 6
ENSDART00000131872 Nonsense 56 172 1 6

The following transcripts of ENSDARG00000053101 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 45718874)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 45810536
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATTCTGACAAACGTGCTTTCTTCACCCTACTTCAAGGTCCAGCTGTAC[G/T]AGCTCAAGACGTACCACGAGGTGGTGGACGAGATTTACTTCAAGGTGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9573
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075080 Nonsense 492 501 6 6
ENSDART00000131872   None 172 None 6

The following transcripts of ENSDARG00000053101 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 45711102)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 45802764
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAACGAATACATGCAAGACAAGASCGCCCCAGTTCTGAATCTGGAGAA[C/T]RAACAAACAGTGTTCGAGCAGATTCTCCCTGATCCAAGTTTGTCTTCTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link