hsf2

Ensembl ID:
ENSDARG00000053097
ZFIN ID:
ZDB-GENE-011128-1
Description:
heat shock factor protein 2 [Source:RefSeq peptide;Acc:NP_571942]
Human Orthologue:
HSF2
Human Description:
heat shock transcription factor 2 [Source:HGNC Symbol;Acc:5225]
Mouse Orthologues:
Hsf2, Hsf3
Mouse Descriptions:
heat shock factor 2 Gene [Source:MGI Symbol;Acc:MGI:96239]
heat shock transcription factor 3 Gene [Source:MGI Symbol;Acc:MGI:3045337]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37125 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37125
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075070 Nonsense 353 489 10 12
ENSDART00000142029 Nonsense 353 489 11 13
Genomic Location (Zv9):
Chromosome 20 (position 40510095)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 40581254
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTTAATTGTTTTCACTGTAAATCACTACAGAGTTGAGCTGATGGACTA[T/A]CTGGATAGTATTGACTGCAGCCTGGAAGACTTCCAGGCCATGCTATATGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link