si:ch211-204c21.1

Ensembl ID:
ENSDARG00000053091
ZFIN ID:
ZDB-GENE-030429-35
Description:
Novel protein similar to vertebrate disabled homolog 2, mitogen-responsive phosphoprotein (Drosophil
Human Orthologue:
BDP1
Human Description:
B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB [Source:HGNC Sy
Mouse Orthologue:
Bdp1
Mouse Description:
B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB Gene [Source:MG

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6060 Nonsense Mutation detected in F1 DNA During 2017
sa26556 Nonsense Mutation detected in F1 DNA During 2017
sa33686 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6060
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122353   None 636 None 15
ENSDART00000123943   None 485 None 11
ENSDART00000128763   None 2342 None 43
ENSDART00000142271 Nonsense 143 491 5 12
ENSDART00000147252   None 202 None 3
Genomic Location (Zv9):
Chromosome 5 (position 45512076)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 43293341
KASP Assay ID:
554-3922.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGATGTCACTGACAGCAGAGCTTTCGGCTACGTGTGTGGCGCGGAGGGC[C/T]AGCACCAGTTCTTCGCTATTAAAACAGCACAGCAGGTACAGAGAGATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26556
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122353 Nonsense 280 636 3 15
ENSDART00000123943 Nonsense 280 485 4 11
ENSDART00000128763 Nonsense 329 2342 4 43
ENSDART00000142271   None 491 None 12
ENSDART00000147252   None 202 None 3
Genomic Location (Zv9):
Chromosome 5 (position 45473255)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 43254520
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACTTCTAATGCAGCAACGGCGCGGACGGCATAAGCGCGAACATGTCTA[T/A]GAGATGGATCCTGATAAAATGACTTTAGCTGACTTCATTTATTACATCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33686
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122353   None 636 None 15
ENSDART00000123943 Nonsense 333 485 6 11
ENSDART00000128763 Nonsense 382 2342 6 43
ENSDART00000142271   None 491 None 12
ENSDART00000147252   None 202 None 3
Genomic Location (Zv9):
Chromosome 5 (position 45470265)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 43251530
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTCTCTCTCTCTCTCTCTCTCTCAGGGTGCAGAAATACATGGCAGAT[G/T]AGGATGATGATGATGCAGATGATGATATGCTGGTTCCTAAAGTGAGGGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link