AMFR (2 of 2)

Ensembl ID:
ENSDARG00000053049
Description:
autocrine motility factor receptor [Source:HGNC Symbol;Acc:463]
Human Orthologue:
AMFR
Human Description:
autocrine motility factor receptor [Source:HGNC Symbol;Acc:463]
Mouse Orthologue:
Amfr
Mouse Description:
autocrine motility factor receptor Gene [Source:MGI Symbol;Acc:MGI:1345634]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21004 Essential Splice Site Mutation detected in F1 DNA During 2014
sa10615 Nonsense Available for shipment Available now
sa15100 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21004
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075014 Essential Splice Site 168 452 5 11
Genomic Location:
Chromosome 7 (position 36703052)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAATCTGTAGCCATCATTTGACTATGATGTTGTTTGTTTGTATTTTATA[G/A]CTCTCATCTTCCCCCTCCAGCACGGCACTGGGAAGCCATATGCATTTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10615
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075014 Nonsense 184 452 5 11
Genomic Location:
Chromosome 7 (position 36703102)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCTCATCTTCCCCCTCCAGCACGGCACTGGGAAGCCATATGCATTTGT[T/A]GTTGGTGTTGATGTGTTTGTTTGTGTCCTCTGGGGGGCTCACCATCATAW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15100
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075014 Nonsense 316 452 8 11
Genomic Location:
Chromosome 7 (position 36719844)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGAAATGCAGCGCAAATTRTTTCAACACAAGAACTACATGCACATATA[T/A]GATGTTATGGACACAAGGTATGTTTTACTGCTAAGYTTTTTNNNNTATMY
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0vtaykef