eif2s2

Ensembl ID:
ENSDARG00000053047
ZFIN ID:
ZDB-GENE-030131-3085
Description:
eukaryotic translation initiation factor 2 subunit 2 [Source:RefSeq peptide;Acc:NP_997840]
Human Orthologue:
EIF2S2
Human Description:
eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa [Source:HGNC Symbol;Acc:3266]
Mouse Orthologue:
Eif2s2
Mouse Description:
eukaryotic translation initiation factor 2, subunit 2 (beta) Gene [Source:MGI Symbol;Acc:MGI:1914454

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20816 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20816
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075009 Nonsense 260 327 8 9
Genomic Location:
Chromosome 6 (position 49961113)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATAGATGGAAACAATCAGCTCGTCATCAAAGGCAGATTCCAGCAGAAA[C/T]AGATAGAGAACGTCTTAAGAAGATACATAAGTGAGTGTTTATTTGACTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Breast cancer: A meta-analysis of genome-wide association studies of breast cancer identifies two novel susceptibility loci at 6q14 and 20q11. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jp6uuhvy