kif19

Ensembl ID:
ENSDARG00000053026
ZFIN ID:
ZDB-GENE-080215-2
Description:
Kif19 protein [Source:UniProtKB/TrEMBL;Acc:A4IGD6]
Mouse Orthologue:
Kif19a
Mouse Description:
kinesin family member 19A Gene [Source:MGI Symbol;Acc:MGI:2447024]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22161 Essential Splice Site Available for shipment Available now
sa42087 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa22161
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130371 Essential Splice Site 194 1015 6 20
Genomic Location (Zv9):
Chromosome 12 (position 40325921)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 38607664
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATACAAGTGGCGGGAATCACAGAGGTCTCCACCATTAATGCACGAGAG[G/A]TTAGAAACATTATTAATAGGCATTTCTTTTTCTTAAAACTCTAAAAGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42087
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130371 Nonsense 231 1015 7 20
Genomic Location (Zv9):
Chromosome 12 (position 40327648)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 38609391
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAGACGTCTTCTCGCTCTCACGCTGTGCTGCAGGTGGTCGTGCGTCAA[C/T]AGAGTCGATGCCGAGACATCCTTCAGGAAGTGCGATTCGCACGACTCTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link