purg

Ensembl ID:
ENSDARG00000053022
ZFIN ID:
ZDB-GENE-070702-3
Human Orthologue:
PURG
Human Description:
purine-rich element binding protein G [Source:HGNC Symbol;Acc:17930]
Mouse Orthologue:
Purg
Mouse Description:
purine-rich element binding protein G Gene [Source:MGI Symbol;Acc:MGI:1922279]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16280 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16280
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074984 Nonsense 226 291 2 2
ENSDART00000145900 Nonsense 258 323 1 1
Genomic Location (Zv9):
Chromosome 10 (position 6163006)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 7606173
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGAGCTCCCCGAGGCGGCGTCGTTCCGCGTCGACARCAAACGCTTTTA[C/A]TTCGACGTSGGCTCAAACCGGTTCGGCGTGTTCCTGAAGATCAGCGAGGW
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link