grsf1

Ensembl ID:
ENSDARG00000053021
ZFIN ID:
ZDB-GENE-060825-196
Description:
G-rich sequence factor 1 [Source:RefSeq peptide;Acc:NP_001039317]
Human Orthologue:
GRSF1
Human Description:
G-rich RNA sequence binding factor 1 [Source:HGNC Symbol;Acc:4610]
Mouse Orthologue:
Grsf1
Mouse Description:
G-rich RNA sequence binding factor 1 Gene [Source:MGI Symbol;Acc:MGI:106479]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15820 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15820
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074973 Essential Splice Site 202 325 5 9
Genomic Location:
Chromosome 5 (position 44565748)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAATGGCTGAAAAGGCCCTGAAGAAAGACAGAGAAATCTTGGGAAATAG[G/A]TTGGTGTATCATCTTGTAATACTAKAAATGAATAAGGACCTTRTACAATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1qz8re2i