grsf1

Ensembl ID:
ENSDARG00000053021
ZFIN ID:
ZDB-GENE-060825-196
Description:
G-rich sequence factor 1 [Source:RefSeq peptide;Acc:NP_001039317]
Human Orthologue:
GRSF1
Human Description:
G-rich RNA sequence binding factor 1 [Source:HGNC Symbol;Acc:4610]
Mouse Orthologue:
Grsf1
Mouse Description:
G-rich RNA sequence binding factor 1 Gene [Source:MGI Symbol;Acc:MGI:106479]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15820 Essential Splice Site Available for shipment Available now
sa40534 Nonsense Mutation detected in F1 DNA During 2016
sa40533 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa15820
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074973 Essential Splice Site 202 325 5 9
Genomic Location (Zv9):
Chromosome 5 (position 44565748)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 42347013
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAATGGCTGAAAAGGCCCTGAAGAAAGACAGAGAAATCTTGGGAAATAG[G/A]TTGGTGTATCATCTTGTAATACTAKAAATGAATAAGGACCTTRTACAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40534
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074973 Nonsense 268 325 8 9
Genomic Location (Zv9):
Chromosome 5 (position 44562937)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 42344202
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCTGAATGACTAGGGGTGTCATTTTTTTTGCAGTTTTTCGCTCCTGTC[C/T]GACTTATGAAGGTTGTTGTAGAGTTTGGTCCTGAAGGAAAACCCACCGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40533
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074973 Nonsense 325 325 9 9
Genomic Location (Zv9):
Chromosome 5 (position 44562665)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 42343930
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGCGATATATTGAGTTGTACCTGAATTCATGTCCACCCAGCGAAGAA[C/T]GATAAGATGAAAGGACACCATATTTAAATGCACTGCATCCCAATCTGCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link