ppp2cb

Ensembl ID:
ENSDARG00000053020
ZFIN ID:
ZDB-GENE-040426-2487
Description:
serine/threonine-protein phosphatase 2A catalytic subunit beta isoform [Source:RefSeq peptide;Acc:N
Human Orthologues:
PPP2CA, PPP2CB
Human Descriptions:
protein phosphatase 2, catalytic subunit, alpha isozyme [Source:HGNC Symbol;Acc:9299]
protein phosphatase 2, catalytic subunit, beta isozyme [Source:HGNC Symbol;Acc:9300]
Mouse Orthologues:
Ppp2ca, Ppp2cb
Mouse Descriptions:
protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform Gene [Source:MGI Symbol;Acc:MG
protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform Gene [Source:MGI Symbol;Acc:MGI

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21647 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21647
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062146 Nonsense 134 309 3 7
ENSDART00000145495 Nonsense 69 181 3 5
Genomic Location (Zv9):
Chromosome 10 (position 6199907)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 7643074
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACGAGAGCAGACAGATCACACAAGTGTATGGTTTCTATGACGAGTGCT[T/A]GAGGAAATATGGCAACGCAAATGTCTGGAAATACTTCACAGATCTTTTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link