rnft2

Ensembl ID:
ENSDARG00000053019
ZFIN ID:
ZDB-GENE-050522-168
Description:
RING finger and transmembrane domain-containing protein 2 [Source:RefSeq peptide;Acc:NP_001018369]
Human Orthologue:
RNFT2
Human Description:
ring finger protein, transmembrane 2 [Source:HGNC Symbol;Acc:25905]
Mouse Orthologue:
Rnft2
Mouse Description:
ring finger protein, transmembrane 2 Gene [Source:MGI Symbol;Acc:MGI:2442859]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15084 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15084
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074979 Essential Splice Site 242 443 6 11
Genomic Location:
Chromosome 5 (position 13023742)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATTGTGTATGTGTACTATACCTTCAGYACTGAGGAACTTCAYAACAGG[T/C]ACAGGCCCATTCAACAGAGTCTCCATCATAACTGAYTCCATTTTTTATTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3idis06v