sema4e

Ensembl ID:
ENSDARG00000052997
ZFIN ID:
ZDB-GENE-990715-7
Description:
Semaphorin-4E [Source:UniProtKB/Swiss-Prot;Acc:Q9YHX4]
Human Orthologue:
SEMA4D
Human Description:
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (se
Mouse Orthologue:
Sema4d
Mouse Description:
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (se

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9636 Essential Splice Site Available for shipment Available now
sa9433 Nonsense Available for shipment Available now
sa33031 Nonsense Mutation detected in F1 DNA During 2017
sa19891 Nonsense Available for shipment Available now
sa39940 Nonsense Mutation detected in F1 DNA During 2017
sa33032 Nonsense Mutation detected in F1 DNA During 2017
sa33033 Nonsense Mutation detected in F1 DNA During 2017
sa38359 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa9636
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056252 Essential Splice Site None 766 None 16
ENSDART00000108861 Essential Splice Site 13 762 None 15
ENSDART00000109471 Essential Splice Site None 766 None 16
Genomic Location (Zv9):
Chromosome 2 (position 50142495)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49838027
KASP Assay ID:
2259-2692.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGAACCACTGATGYGTCACAGGARAACTGAGAGACYAACTTGGAAAGG[T/A]AGGCGYATGGGAAGTTGCTGCTGGTCCGGTTTTGACTATTGCWGCATCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9433
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056252 Nonsense 9 766 3 16
ENSDART00000108861   None 762 None 15
ENSDART00000109471 Nonsense 9 766 3 16
Genomic Location (Zv9):
Chromosome 2 (position 50150714)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49846246
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTTTTATAACAAGAGCACTGAATGATGTCTCTGCTGGCTGTTCWGTG[T/A]GTTTTGTATGTCTGGAGTCCAGCAATGCTGACCGGTGGGCTKGGATCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33031
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056252 Nonsense 116 766 6 16
ENSDART00000108861 Nonsense 112 762 5 15
ENSDART00000109471 Nonsense 116 766 6 16
Genomic Location (Zv9):
Chromosome 2 (position 50157196)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49852728
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCGTGTTGTTTTTGTCTTCTTCTTTAGAATGACTGCAAAAACTATATT[C/T]GAATTCTTCATAAAAAGGACGACGGCAGAATGTATGTCTGTGGAACCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19891
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056252 Nonsense 161 766 7 16
ENSDART00000108861 Nonsense 157 762 6 15
ENSDART00000109471 Nonsense 161 766 7 16
Genomic Location (Zv9):
Chromosome 2 (position 50157424)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49852956
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGGTAAGCTGACTTTAGAGATCCTCCAAGAAGATACGAAAGGGAAATG[T/A]CCGTTCGACCCTTTTCAGCGATATACATCTGCAATGGTCGGTACGTACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39940
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056252 Nonsense 272 766 10 16
ENSDART00000108861 Nonsense 268 762 9 15
ENSDART00000109471 Nonsense 272 766 10 16
Genomic Location (Zv9):
Chromosome 2 (position 50161013)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49856545
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAAATCATTTTATCCTCCCAGGGTGACTTGGGTGGGCAGAGAACGCTA[C/T]AAAAGAAGTGGACGTCATTTCTAAAAGCTAGGTTCGACTGTCAAGTTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33032
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056252 Nonsense 637 766 16 16
ENSDART00000108861 Nonsense 633 762 15 15
ENSDART00000109471 Nonsense 637 766 16 16
Genomic Location (Zv9):
Chromosome 2 (position 50173357)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49868889
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTACATCTGCAGCTCCATCGAGACCGTCTCCCAGCGCAAATACCAGACT[C/T]AGCATGTAGCGTATGATGTAAAGATGTGGTCCGAATCTGGAACCACAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33033
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056252 Nonsense 720 766 16 16
ENSDART00000108861 Nonsense 716 762 15 15
ENSDART00000109471 Nonsense 720 766 16 16
Genomic Location (Zv9):
Chromosome 2 (position 50173607)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49869139
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGCACGAAGACGATGCTAACCAGGTTCAGCCACAGAGACTAGCATCAT[C/A]GGTAGTGAACTTCAACAGCAACAACAACCACGCCAATGACCAGAGGTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38359
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056252 Nonsense 744 766 16 16
ENSDART00000108861 Nonsense 740 762 15 15
ENSDART00000109471 Nonsense 744 766 16 16
Genomic Location (Zv9):
Chromosome 2 (position 50173678)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49869210
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAACAACCACGCCAATGACCAGAGGTATTCCAGCTCTAGAGAAACAGAC[A/T]GACTCTCGACCACTGCTGGGTCCACAGGTCAGATGTCACTGAAATACATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link