mbnl1

Ensembl ID:
ENSDARG00000052978
ZFIN ID:
ZDB-GENE-060929-704
Description:
muscleblind-like protein 1 isoform 1 [Source:RefSeq peptide;Acc:NP_001070102]
Human Orthologue:
MBNL1
Human Description:
muscleblind-like (Drosophila) [Source:HGNC Symbol;Acc:6923]
Mouse Orthologue:
Mbnl1
Mouse Description:
muscleblind-like 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1928482]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5722 Splice Site, Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa5722
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074924 None None 409 None 21
ENSDART00000074929 None None 400 None 14
ENSDART00000098061 Splice Site, Nonsense 160 424 4 18
ENSDART00000124307 Splice Site, Nonsense 160 412 4 17
ENSDART00000126200 None None 118 None 3
Genomic Location:
Chromosome 2 (position 47926190)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGTCACTTTTAAGTCAGCCACCTTTTGTTTTGCAATAAAATACCTGCA[C/T]GTTTCCCATACTGCTATATTTTACTGCTAAATATTTTAAYATTTTTCCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/air147gw