mbnl1

Ensembl ID:
ENSDARG00000052978
ZFIN ID:
ZDB-GENE-060929-704
Description:
muscleblind-like protein 1 isoform 1 [Source:RefSeq peptide;Acc:NP_001070102]
Human Orthologue:
MBNL1
Human Description:
muscleblind-like (Drosophila) [Source:HGNC Symbol;Acc:6923]
Mouse Orthologue:
Mbnl1
Mouse Description:
muscleblind-like 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1928482]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5722 Splice Site, Nonsense F2 line generated During 2016
sa33021 Essential Splice Site, Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa5722
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074924   None 409 None 21
ENSDART00000074929   None 400 None 14
ENSDART00000098061 Splice Site, Nonsense 160 424 4 18
ENSDART00000124307 Splice Site, Nonsense 160 412 4 17
ENSDART00000126200   None 118 None 3
Genomic Location (Zv9):
Chromosome 2 (position 47926190)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 47948454
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGTCACTTTTAAGTCAGCCACCTTTTGTTTTGCAATAAAATACCTGCA[C/T]GTTTCCCATACTGCTATATTTTACTGCTAAATATTTTAAYATTTTTCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33021
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074924 Essential Splice Site 280 409 16 21
ENSDART00000074929 Splice Site None 400 None 14
ENSDART00000098061   None 424 None 18
ENSDART00000124307   None 412 None 17
ENSDART00000126200   None 118 None 3
Genomic Location (Zv9):
Chromosome 2 (position 47931393)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 47963057
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCGTCTGCCAGAAACATTTGAGTAGTGCTTCGCTTGCTTCATTTGCAT[T/G]GAGTTAGCAGTATGGATGTTGTAATGTTAATGACTTTTTTTAATACTCTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link