ubin

Ensembl ID:
ENSDARG00000052975
ZFIN ID:
ZDB-GENE-030131-6269
Description:
ubiquilin-4 [Source:RefSeq peptide;Acc:NP_998521]
Human Orthologue:
UBQLN4
Human Description:
ubiquilin 4 [Source:HGNC Symbol;Acc:1237]
Mouse Orthologue:
Ubqln4
Mouse Description:
ubiquilin 4 Gene [Source:MGI Symbol;Acc:MGI:2150152]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9131 Nonsense Mutation detected in F1 DNA During 2014
sa15580 Nonsense Available for shipment Available now
sa22943 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9131
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058327 Nonsense 43 497 1 9
ENSDART00000074919 Nonsense 43 599 1 11
ENSDART00000142698 Nonsense 43 497 1 9
Genomic Location:
Chromosome 16 (position 49732746)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAAGGTTACCGTCAAAACACCGAAGGATAAAGAAGAAATAGCCAWCGCC[G/T]AGGACGCATCTGTCGCACAAGYGAGTTTATTCGCGGTTTCTTGTAGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15580
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058327 None None 497 None 9
ENSDART00000074919 Nonsense 415 599 7 11
ENSDART00000142698 Nonsense 415 497 7 9
Genomic Location:
Chromosome 16 (position 49725867)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATATGCGCACCATGATGCAATCCCTSGCCCAGAATCCTGATGTTGYCT[C/A]ACAGGTAGCCGGACAATAATTTAAAAGCTCCCTGGTGTTTTCAGATTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22943
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058327 Essential Splice Site 447 497 None 9
ENSDART00000074919 Essential Splice Site 549 599 None 11
ENSDART00000142698 Essential Splice Site 447 497 None 9
Genomic Location:
Chromosome 16 (position 49723379)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGCTCATGCAGCAGATGCTACAGATGTTTGCTGGAGGGAGCGCATCGG[T/C]ACTCATGTTTTAATCTTTTTGCTAATAGCAGTTGTCAACAGTATTAATAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/f1pltwft