plcd3a

Ensembl ID:
ENSDARG00000052957
ZFIN ID:
ZDB-GENE-070620-1
Description:
1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase delta-3-A [Source:UniProtKB/Swiss-Prot;Acc
Human Orthologue:
PLCD3
Human Description:
phospholipase C, delta 3 [Source:HGNC Symbol;Acc:9061]
Mouse Orthologue:
Plcd3
Mouse Description:
phospholipase C, delta 3 Gene [Source:MGI Symbol;Acc:MGI:107451]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44568 Essential Splice Site Mutation detected in F1 DNA During 2017
sa20090 Nonsense Available for shipment Available now
sa40128 Nonsense Mutation detected in F1 DNA During 2017
sa33259 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44568
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102674 Essential Splice Site 30 784 1 15
Genomic Location (Zv9):
Chromosome 3 (position 39299600)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTCCAAATCGGTGGAGTCGAAAACTCACGATCCGCTGCGGAGGCTTGG[T/C]GAGTTTTGTCTTACTTCAGGACAAGTGTGTTTTTAAAAGTTACTTGAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20090
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102674 Nonsense 134 784 3 15
Genomic Location (Zv9):
Chromosome 3 (position 39275863)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39139223
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGTGGTTTTCCGTGGAGGAAGGAAAAGCCTGGATCTGTGCTGCCACACA[C/T]AAGAGGAAGCGGAGCGCTGGGTCCGAGGCATCCGCACACTAAAAGACCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40128
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102674 Nonsense 158 784 3 15
Genomic Location (Zv9):
Chromosome 3 (position 39275791)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39139151
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCGAGGCATCCGCACACTAAAAGACCGCGTCTCCAACATGAGCCAGAAA[G/T]AGAAGCTCGACCAATATCCTTATTAAATAATAACAATACAATAAGAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33259
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102674 Nonsense 201 784 4 15
Genomic Location (Zv9):
Chromosome 3 (position 39273238)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39136598
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAACATCTGCTCCAGCTGATTAACATTGACCTAAATGAGCAGTACGCA[C/T]GAACGCTCTTCAAGGTTTGTGTGACAGCAGCCGATGCCATAAACAACATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link