ENSDARG00000052950

Ensembl ID:
ENSDARG00000052950
Human Orthologues:
AC140658.1, AC142086.3, AC142381.2, ARHGAP23
Human Descriptions:
Rho GTPase activating protein 23 [Source:HGNC Symbol;Acc:29293]
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A8MTI0]
Mouse Orthologue:
Arhgap23
Mouse Description:
Rho GTPase activating protein 23 Gene [Source:MGI Symbol;Acc:MGI:3697726]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2101 Essential Splice Site F2 line generated During 2014
sa20091 Essential Splice Site Available for shipment Available now
sa5219 Nonsense Mutation detected in F1 DNA During 2014
sa5730 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa2101
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074883 Essential Splice Site 369 1377 8 31
Genomic Location:
Chromosome 3 (position 39343566)
KASP Assay ID:
554-2819.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAGGGTTGAAAGATCTGCTTGGGTTCAACAACCTCCAAATAGGACTGAA[G/A]TCTATGCAAGACATGCTGGGCATTTCGGCCAACATATAGAGTCACCCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20091
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074883 Essential Splice Site 631 1377 12 31
Genomic Location:
Chromosome 3 (position 39330128)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGTGATGAGGGGCTTAACGCATATAGAGAAGAGGGCCGGGTCTTCTCG[T/C]GAGTTTTGGGATTTTTTACTATACTGTTATGATTTGCACTATAATGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5219
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074883 Nonsense 678 1377 14 31
Genomic Location:
Chromosome 3 (position 39327416)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACCTCTGAGCTGGGCAACATCAGCTACAGTGACGTGAAGAGAGAAGGCT[G/A]GCTCCACTTCAAACAGATCCACACGGAGAAGGGCAAGGTAAGAGAAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5730
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074883 Essential Splice Site 1310 1377 30 31
Genomic Location:
Chromosome 3 (position 39311475)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTCCGAACTCTCGAGCTCCTCCGCCGCAGAGGAGGAYCGCCAGTCAGG[T/C]GCCAATCAAATCCCTGACTCCTCTCCGTCTCCTTCTTCAAAAGCCAAAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Ovarian cancer: GWAS meta-analysis and replication identifies three new susceptibility loci for ovarian cancer. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/p90000cx