aspg

Ensembl ID:
ENSDARG00000052942
ZFIN ID:
ZDB-GENE-070820-14
Description:
asparaginase homolog [Source:RefSeq peptide;Acc:NP_001096091]
Human Orthologue:
ASPG
Human Description:
asparaginase homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:20123]
Mouse Orthologue:
Aspg
Mouse Description:
asparaginase homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2144822]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17418 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17418
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074875 Nonsense 181 626 4 16
ENSDART00000109525 Nonsense 203 665 4 18
ENSDART00000135073 Nonsense 203 648 4 16
ENSDART00000143525 Nonsense 215 289 5 7
ENSDART00000145882 None None 74 None 4

The following transcripts of ENSDARG00000052942 do not overlap with this mutation:

Genomic Location:
Chromosome 17 (position 45916187)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAYGGTACAGACACTATGGCTTACACCGCATCTGCCTTATCCTTCATGTG[T/A]GARARCCTKGGGAAGCCRGTCATCCTCACWGGATCACAGGTAAMCTAYAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8ky31r6w