im:7154842

Ensembl ID:
ENSDARG00000052917
ZFIN ID:
ZDB-GENE-080917-19
Description:
CAPN1 protein [Source:UniProtKB/TrEMBL;Acc:Q58EB1]
Human Orthologues:
CAPN13, CAPN14
Human Descriptions:
calpain 13 [Source:HGNC Symbol;Acc:16663]
calpain 14 [Source:HGNC Symbol;Acc:16664]
Mouse Orthologue:
Capn13
Mouse Description:
calpain 13 Gene [Source:MGI Symbol;Acc:MGI:2685789]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36517 Nonsense Mutation detected in F1 DNA During 2017
sa2897 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa36517
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074854 Nonsense 180 726 5 22
Genomic Location (Zv9):
Chromosome 17 (position 45748157)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 45597389
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCACACTTCTGTTGTTGTAAATTTATAGTTCTGGCGCTTTGGAAAATG[G/A]TTCGATGTAGTGATTGACGACAAGCTGCCAACAATCAATCGCCAGCTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2897
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074854 Nonsense 604 726 17 22
Genomic Location (Zv9):
Chromosome 17 (position 45762141)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 45611373
KASP Assay ID:
554-2540.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGATCTTTTAGGGAGAAAAAATGCTGAAGGATTTGGGCTGGATTCCTG[T/A]AGAAGTATGATWGCCATGTCAGATGTATCCTTTCTTCTTGAAAATCGNNN
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link