tpra

Ensembl ID:
ENSDARG00000052914
ZFIN ID:
ZDB-GENE-081104-2
Description:
Novel protein similar to vertebrate translocated promoter region (To activated MET oncogene) (TPR) [
Human Orthologue:
TPR
Human Description:
translocated promoter region (to activated MET oncogene) [Source:HGNC Symbol;Acc:12017]
Mouse Orthologue:
Tpr
Mouse Description:
translocated promoter region Gene [Source:MGI Symbol;Acc:MGI:1922066]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10563 Nonsense Available for shipment Available now
sa32892 Nonsense Mutation detected in F1 DNA During 2016
sa32891 Nonsense Available for shipment Available now
sa19727 Nonsense Available for shipment Available now
sa25104 Essential Splice Site Mutation detected in F1 DNA During 2016
sa32890 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10563
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027144   None 366 None 11
ENSDART00000074850   None 1309 None 28
ENSDART00000111541 Nonsense 92 1274 3 28
ENSDART00000142968   None 198 None 6
Genomic Location (Zv9):
Chromosome 2 (position 20660889)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21206827
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAACATGATTGCGTGTGTTTTGATTGTTAAGTGGAAGAGCTTAAGAAGT[T/G]AAAAGAGATAGAAGAAGTGCAGGGAACAAYGCAAGAGGTAACTATTTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32892
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027144   None 366 None 11
ENSDART00000074850   None 1309 None 28
ENSDART00000111541 Nonsense 179 1274 6 28
ENSDART00000142968   None 198 None 6
Genomic Location (Zv9):
Chromosome 2 (position 20659360)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21205298
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAAATGGTGTACTTCACTTTGTTTCAGTATCGTGAGAAGCGGATGGAA[C/T]AAGAAAAAGAGCTTCTCCAGAACCAGAACACATGGCTGAACACAGAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32891
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027144   None 366 None 11
ENSDART00000074850   None 1309 None 28
ENSDART00000111541 Nonsense 283 1274 8 28
ENSDART00000142968   None 198 None 6
Genomic Location (Zv9):
Chromosome 2 (position 20658881)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21204819
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAAGTACCGCAATGAGCTGAATGCAAACCTCAAACTATGTAATTTGTA[C/A]AAGGTCAGTTAAACATTTATTTATTTATTTATTTTATTGACTTGCTGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19727
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027144   None 366 None 11
ENSDART00000074850   None 1309 None 28
ENSDART00000111541 Nonsense 439 1274 12 28
ENSDART00000142968   None 198 None 6
Genomic Location (Zv9):
Chromosome 2 (position 20645256)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21191194
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGAGGTGGAAACCAAAGCTCCCATCCTGAAACGCCAGAGAGAGGAATA[T/G]GAGAGCATGCAGAAGTCTATGACCAGTCTCTGTTATAAACTAGAGCAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25104
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027144   None 366 None 11
ENSDART00000074850   None 1309 None 28
ENSDART00000111541 Essential Splice Site 458 1274 12 28
ENSDART00000142968   None 198 None 6
Genomic Location (Zv9):
Chromosome 2 (position 20645198)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21191136
KASP Assay ID:
554-7472.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGAAGTCTATGACCAGTCTCTGTTATAAACTAGAGCAAGCTATGAAG[G/A]TTTGCACACATTTGAGAGCTAATGCAAAAAGAAGGAACAGGATAATGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32890
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027144   None 366 None 11
ENSDART00000074850 Nonsense 877 1309 17 28
ENSDART00000111541   None 1274 None 28
ENSDART00000142968   None 198 None 6
Genomic Location (Zv9):
Chromosome 2 (position 20596879)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21166302
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCAACCCTCTGAGTCTCAGATCAGTGGACAGGACTCATCAGAAGAGTA[C/A]AAGCATGATGTAATCGTCATCGAAACAGACAGCGCCACTGAGGAGGAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link