LOC100334148

Ensembl ID:
ENSDARG00000052912
Human Orthologue:
RP11-723O4.6
Human Description:
Uncharacterized protein FLJ43738 [Source:UniProtKB/Swiss-Prot;Acc:Q6ZUG5]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21926 Nonsense Mutation detected in F1 DNA During 2014
sa16331 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21926
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074853 Nonsense 110 749 1 9
Genomic Location:
Chromosome 11 (position 27610257)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCATAGCAAAACTAGATCTTTCTGATCTCCTCCAAGGATGCAGATATT[T/A]GAAGCTGACCTTGCCTATTAAGTGTTCTGCCTCTAAGCACATTGAACAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16331
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074853 Nonsense 336 749 3 9
Genomic Location:
Chromosome 11 (position 27611578)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTCACTAAATGTYTCTTACTCACNTTTTTTTAGTWTAAGCCACATTAGG[C/T]AGGCCAAAAYACTTCAAGAAGYGGTGCACARCAATCTTTTCCCTTTAGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/238vfudr