LOC100334148

Ensembl ID:
ENSDARG00000052912
Human Orthologue:
RP11-723O4.6
Human Description:
Uncharacterized protein FLJ43738 [Source:UniProtKB/Swiss-Prot;Acc:Q6ZUG5]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21926 Nonsense Mutation detected in F1 DNA During 2016
sa16331 Nonsense Available for shipment Available now
sa41849 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa21926
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074853 Nonsense 110 749 1 9
Genomic Location:
Chromosome 11 (position 27610257)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCATAGCAAAACTAGATCTTTCTGATCTCCTCCAAGGATGCAGATATT[T/A]GAAGCTGACCTTGCCTATTAAGTGTTCTGCCTCTAAGCACATTGAACAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16331
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074853 Nonsense 336 749 3 9
Genomic Location:
Chromosome 11 (position 27611578)
KASP Assay ID:
2260-4366.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTCACTAAATGTYTCTTACTCACNTTTTTTTAGTWTAAGCCACATTAGG[C/T]AGGCCAAAAYACTTCAAGAAGYGGTGCACARCAATCTTTTCCCTTTAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41849
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074853 Essential Splice Site 474 749 4 9
Genomic Location:
Chromosome 11 (position 27613655)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAATTCTACAATTCGGAGTGGAGAACAACTCTACAGGGAACTATCAAAG[G/A]TTGGCACAAATTTCCATTAAGAACATCTAAGACATACCAAAAAAACCGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link