si:dkey-165i4.1

Ensembl ID:
ENSDARG00000052897
ZFIN ID:
ZDB-GENE-060526-217
Description:
ataxin-2 [Source:RefSeq peptide;Acc:NP_001121821]
Human Orthologue:
ATXN2
Human Description:
ataxin 2 [Source:HGNC Symbol;Acc:10555]
Mouse Orthologue:
Atxn2
Mouse Description:
ataxin 2 Gene [Source:MGI Symbol;Acc:MGI:1277223]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa870 Essential Splice Site Available for shipment Available now
sa16931 Essential Splice Site Available for shipment Available now
sa40527 Nonsense Mutation detected in F1 DNA During 2017
sa33679 Nonsense Mutation detected in F1 DNA During 2017
sa33678 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa870
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083656 Essential Splice Site 95 1112 4 23
Genomic Location (Zv9):
Chromosome 5 (position 43324474)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41105739
KASP Assay ID:
554-0772.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAAAATGGCCTGATCTATGAAGGGGTTTTTAAAACATATGGCCCAGAGG[T/C]AAGGATACCACTTTGTATTGCTGATGTTAAGCATTTCTATCACTGTTAAG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa16931
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083656 Essential Splice Site 146 1112 5 23
Genomic Location (Zv9):
Chromosome 5 (position 43324192)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41105457
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAGTRGTARTTCATTTCAAAGATGTGGAYCTCAACTATGCCAAGAAAGG[T/C]GAGAYCTTCTGTCAAATATTCTTGYTACTTTAATRGGYGTTTTACAGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40527
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083656 Nonsense 590 1112 15 23
Genomic Location (Zv9):
Chromosome 5 (position 43288896)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41070161
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAGAAGCTTCCATTCTTCCATTCACTAAAGCACTGCATTTTTTTGTAGT[T/A]GCAGCCTAGCTCAAGTTCAGATCCAGGTTTTGAAGCTATGGGGACCAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33679
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083656 Nonsense 751 1112 17 23
Genomic Location (Zv9):
Chromosome 5 (position 43286205)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41067470
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCCACTCTGACCCGACCCCAGGGTCAACCCAGCCCTTCCATCGTTGTA[C/T]AGCAGCCTCCTACGGTCTACGGCCAGACCATGTTCCAGATGTACCCGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33678
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083656 Essential Splice Site 923 1112 20 23
Genomic Location (Zv9):
Chromosome 5 (position 43271715)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41052980
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAAGAACTTCCCCAGCACAATGACTAAGCTCAACAAGCCCACATACAGT[G/A]TCACTGCTATGTATTGCTTTTCTTTTCGATAAATAACTCAACTCTACAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link