rx3

Ensembl ID:
ENSDARG00000052893
ZFIN ID:
ZDB-GENE-990415-238
Description:
Retinal homeobox protein Rx3 [Source:UniProtKB/Swiss-Prot;Acc:O42358]
Human Orthologues:
RAX, RAX2
Human Descriptions:
retina and anterior neural fold homeobox 2 [Source:HGNC Symbol;Acc:18286]
retina and anterior neural fold homeobox [Source:HGNC Symbol;Acc:18662]
Mouse Orthologue:
Rax
Mouse Description:
retina and anterior neural fold homeobox Gene [Source:MGI Symbol;Acc:MGI:109632]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa29528 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa29528
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074833 Essential Splice Site 151 292 2 3
Genomic Location (Zv9):
Chromosome 21 (position 9292441)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 10664494
KASP Assay ID:
2261-5277.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAGAGGAGCTCGCGCTGAAGGTCAACCTGCCCGAAGTCCGAGTACAGG[T/G]GAGAGACACTTTATTCTGTTCAAACTAATACAGCAATAATAAATATTGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link