NP_571093.1

Ensembl ID:
ENSDARG00000052866
Description:
huntingtin [Source:RefSeq peptide;Acc:NP_571093]
Human Orthologue:
HTT
Human Description:
huntingtin [Source:HGNC Symbol;Acc:4851]
Mouse Orthologue:
Htt
Mouse Description:
huntingtin Gene [Source:MGI Symbol;Acc:MGI:96067]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15014 Essential Splice Site Available for shipment Available now
sa39659 Nonsense Mutation detected in F1 DNA During 2018
sa19545 Nonsense Available for shipment Available now
sa39658 Essential Splice Site Mutation detected in F1 DNA During 2018
sa38282 Essential Splice Site Mutation detected in F1 DNA During 2018
sa45079 Nonsense Mutation detected in F1 DNA During 2018
sa19544 Nonsense Available for shipment Available now
sa39657 Nonsense Mutation detected in F1 DNA During 2018
sa12352 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15014
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074777 Essential Splice Site 385 3121 11 67
Genomic Location (Zv9):
Chromosome 1 (position 41740855)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 40657096
GRCz11 1 41359883
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGKAGAAAMATGGTGTTGTAACAATATGCMTTGTATGTTATGCTTTTATT[A/T]GGCAAACTGTTGTCAGGTGAAGAAGARGGTTTGGARGAWGATCCTGAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39659
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074777 Nonsense 472 3121 12 67
Genomic Location (Zv9):
Chromosome 1 (position 41736149)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 40652390
GRCz11 1 41355177
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGTGCATCAGAGCAGGGAGTCGGGCCTGATACTCCAGATGAGGAAGAC[G/T]AGGAAGACATGCTAAGCCGTAGCTCAAGCGGAGGCGCCGGGCTTGTCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19545
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074777 Nonsense 546 3121 13 67
Genomic Location (Zv9):
Chromosome 1 (position 41733641)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 40649882
GRCz11 1 41352669
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCTGATGTGTAGGTGCTGGATGGCAGTGAGAGTCAGTACTCAGGGATG[C/T]AGATCGGCACACTGCAGGATGAGGAGGAGGAGGGCTCGGCTCCACCACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39658
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074777 Essential Splice Site 1074 3121 26 67
Genomic Location (Zv9):
Chromosome 1 (position 41721538)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 40637779
GRCz11 1 41340566
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTACTGTTCTTTGTTTGTATTTAACGTGTTTTTGCACCTGCTTTTGTA[G/A]CTGTTGCACCCAAGTGCATGAAGAGTCCATGGGCAGGTGAGGAGGAGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38282
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074777 Essential Splice Site 2188 3121 49 67
Genomic Location (Zv9):
Chromosome 1 (position 41697217)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 40613458
GRCz11 1 41316245
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATATAGATACTCTGATTGCATATGTTTGTGTGTGTGTGTGTGTGTTGC[A/G]GGTGAGCCTGGGTTTTATCAGACTGTGTTGAGTCTGTGTGGCGTGTTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45079
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074777 Nonsense 2330 3121 52 67
Genomic Location (Zv9):
Chromosome 1 (position 41693844)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 40610085
GRCz11 1 41312872
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACATGAGTTGCTATGTCTGTGATTTTTAGACCAGCGTGAATGGCATTG[T/A]TGTGAGATCATGGCTGAGCTGGTTGAAGGTCTGCAGACTGTCCTGACTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19544
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074777 Nonsense 2714 3121 60 67
Genomic Location (Zv9):
Chromosome 1 (position 41686043)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 40602284
GRCz11 1 41305071
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGAACTGCAGAAGGTGCATCCACCAGAAGATGAGATCCTCAACCAATA[C/A]CTTGTTCCAGCAATCTGTAAAGCAGCAGCAGTGCTTGGCATGGTGAGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39657
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074777 Nonsense 2951 3121 65 67
Genomic Location (Zv9):
Chromosome 1 (position 41679313)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 40595554
GRCz11 1 41298341
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTAATCTGTGGCAATTTCTTGCGCCAGGATTCGCAAAGGTTTTCCGAGT[G/T]AGGCACGTGTTGTGGCCAGGATCCTTCCTCAGTTCCTGGATGACTTTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12352
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074777 Nonsense 3081 3121 67 67
Genomic Location (Zv9):
Chromosome 1 (position 41676475)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 40592716
GRCz11 1 41295503
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGTGGACATTAGCCTCTTTTGCTTGRTCGCTATGGACTTCTACCGACAT[C/T]AGATCGATGAGGAGTTAGACCGCAGGGCCTTCCAGTCTGTCTTTGAGATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link