khdrbs1a

Ensembl ID:
ENSDARG00000052856
ZFIN ID:
ZDB-GENE-000210-25
Description:
KH domain containing, RNA binding, signal transduction associated 1a [Source:RefSeq peptide;Acc:NP_
Human Orthologue:
KHDRBS1
Human Description:
KH domain containing, RNA binding, signal transduction associated 1 [Source:HGNC Symbol;Acc:18116]
Mouse Orthologue:
Khdrbs1
Mouse Description:
KH domain containing, RNA binding, signal transduction associated 1 Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16353 Nonsense Available for shipment Available now
sa22375 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16353
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074787 Nonsense 283 370 6 9
ENSDART00000125633 Nonsense 283 369 6 11
Genomic Location:
Chromosome 13 (position 45638160)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACCAACCCAAGCYGCCAGAATGACACCTGCAGCCGGACTCTCCCACCAA[C/T]AGGCCAAACCTGAARCTTWCGGAGAATATGTGAGTCAATATAYATAGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22375
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074787 None None 370 9 9
ENSDART00000125633 Essential Splice Site None 369 None 11
Genomic Location:
Chromosome 13 (position 45635655)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTGCCTGCGCAGCCTCCTTCCCTCGTAACCTCTTGTTATCATCTAAAG[T/C]AATTCTAGTTGTTATTTTTGTATGCTGTTTTGGTTAACACACTCCTTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yffj10rz