khdrbs1a

Ensembl ID:
ENSDARG00000052856
ZFIN ID:
ZDB-GENE-000210-25
Description:
KH domain containing, RNA binding, signal transduction associated 1a [Source:RefSeq peptide;Acc:NP_
Human Orthologue:
KHDRBS1
Human Description:
KH domain containing, RNA binding, signal transduction associated 1 [Source:HGNC Symbol;Acc:18116]
Mouse Orthologue:
Khdrbs1
Mouse Description:
KH domain containing, RNA binding, signal transduction associated 1 Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35582 Nonsense Mutation detected in F1 DNA During 2016
sa16353 Nonsense Available for shipment Available now
sa22375 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa35582
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074787 Nonsense 133 370 4 9
ENSDART00000125633 Nonsense 133 369 4 11
Genomic Location:
Chromosome 13 (position 45638896)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCTTTGCCTGCAGGAAGAGGAGCTAAGGAAGGGTGGAGATCCAAAGTA[T/A]GCACACTTGGGGATGGAGCTGCATGTGCATATTGAGGTCTTTGCTCCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16353
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074787 Nonsense 283 370 6 9
ENSDART00000125633 Nonsense 283 369 6 11
Genomic Location:
Chromosome 13 (position 45638160)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACCAACCCAAGCYGCCAGAATGACACCTGCAGCCGGACTCTCCCACCAA[C/T]AGGCCAAACCTGAARCTTWCGGAGAATATGTGAGTCAATATAYATAGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22375
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074787   None 370 9 9
ENSDART00000125633 Essential Splice Site None 369 None 11
Genomic Location:
Chromosome 13 (position 45635655)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTGCCTGCGCAGCCTCCTTCCCTCGTAACCTCTTGTTATCATCTAAAG[T/C]AATTCTAGTTGTTATTTTTGTATGCTGTTTTGGTTAACACACTCCTTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link