golph3

Ensembl ID:
ENSDARG00000052851
ZFIN ID:
ZDB-GENE-041010-209
Description:
golgi phosphoprotein 3 [Source:RefSeq peptide;Acc:NP_001006105]
Human Orthologue:
GOLPH3
Human Description:
golgi phosphoprotein 3 (coat-protein) [Source:HGNC Symbol;Acc:15452]
Mouse Orthologue:
Golph3
Mouse Description:
golgi phosphoprotein 3 Gene [Source:MGI Symbol;Acc:MGI:1913879]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10209 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10209
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051070 Nonsense 74 295 2 4
ENSDART00000074781 None None 251 None 3
Genomic Location:
Chromosome 5 (position 42712634)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAACTGCATGTATACTTAATCCGTTGGTATTGTTTTTGTGYAAGGGTTA[C/A]ACCTCCTTCTGGAACGACTGCATTTCGTCTGGCCTGAGGGGCTGCATGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dz4isjj0