top3a

Ensembl ID:
ENSDARG00000052827
ZFIN ID:
ZDB-GENE-071212-2
Human Orthologue:
TOP3A
Human Description:
topoisomerase (DNA) III alpha [Source:HGNC Symbol;Acc:11992]
Mouse Orthologue:
Top3a
Mouse Description:
topoisomerase (DNA) III alpha Gene [Source:MGI Symbol;Acc:MGI:1197527]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10806 Essential Splice Site Available for shipment Available now
sa10899 Essential Splice Site Available for shipment Available now
sa11092 Essential Splice Site Available for shipment Available now
sa18763 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa10806
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102492 Essential Splice Site 100 1009 3 19
ENSDART00000102492 Essential Splice Site 100 1009 3 19
ENSDART00000102492 Essential Splice Site 100 1009 3 19
Genomic Location:
Chromosome 3 (position 40248307)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAAACATGACGTCAGTATCAGGGCATCTCTTGGCTCTTGAATTCAAAGC[T/C]CCTTTTCAGAAATGGTAAGTTTTATATACAGTTRAAGYCAGAATTATTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10899
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102492 Essential Splice Site 100 1009 3 19
ENSDART00000102492 Essential Splice Site 100 1009 3 19
ENSDART00000102492 Essential Splice Site 100 1009 3 19
Genomic Location:
Chromosome 3 (position 40248307)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAAACATGACGTCAGTATCAGGGCATCTCTTGGCTCTTGAATTCAAAGC[T/C]CCTTTTCAGAAATGGTAAGTTTTATATACAGTTRAAGYCAGAATTATTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11092
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102492 Essential Splice Site 100 1009 3 19
ENSDART00000102492 Essential Splice Site 100 1009 3 19
ENSDART00000102492 Essential Splice Site 100 1009 3 19
Genomic Location:
Chromosome 3 (position 40248307)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAAACATGACGTCAGTATCAGGGCATCTCTTGGCTCTTGAATTCAAAGC[T/C]CCTTTTCAGAAATGGTAAGTTTTATATACAGTTRAAGYCAGAATTATTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18763
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102492 Nonsense 287 1009 8 19
Genomic Location:
Chromosome 3 (position 40244570)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCATGAACCTAATGAAGAGGAGTCAGTGGAATTCAACTGGAAAAGACAT[C/T]GACTGTTCAATCACACCGCATGCCTTGTGCTGTATCAGATGTGCATGGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qluthl1d