shmt1

Ensembl ID:
ENSDARG00000052816
ZFIN ID:
ZDB-GENE-040426-1558
Description:
serine hydroxymethyltransferase, cytosolic [Source:RefSeq peptide;Acc:NP_957340]
Human Orthologue:
SHMT1
Human Description:
serine hydroxymethyltransferase 1 (soluble) [Source:HGNC Symbol;Acc:10850]
Mouse Orthologue:
Shmt1
Mouse Description:
serine hydroxymethyltransferase 1 (soluble) Gene [Source:MGI Symbol;Acc:MGI:98299]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa26132 Splice Site, Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa26132
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074737 Splice Site None 481 None 12
ENSDART00000124883 Nonsense 20 504 3 14
ENSDART00000132225 Splice Site None 236 None 7
ENSDART00000141578   None 248 1 6
Genomic Location (Zv9):
Chromosome 3 (position 40269844)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 40133204
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTACACTATGTTTTGCATTTGGCAGTCTTGTATTGATTAATAATGTTTA[T/A]TCCAGTTCATCAACCATGTCCCAGCTCAACGGTCATACTGAGAAAACATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link