alad

Ensembl ID:
ENSDARG00000052815
ZFIN ID:
ZDB-GENE-050417-123
Description:
delta-aminolevulinic acid dehydratase [Source:RefSeq peptide;Acc:NP_001017645]
Human Orthologue:
ALAD
Human Description:
aminolevulinate dehydratase [Source:HGNC Symbol;Acc:395]
Mouse Orthologue:
Alad
Mouse Description:
aminolevulinate, delta-, dehydratase Gene [Source:MGI Symbol;Acc:MGI:96853]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20556 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20556
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074740 Essential Splice Site None 331 None 12

The following transcripts of ENSDARG00000052815 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 62950765)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGATCTGGGTCATTTACGGTTTCTCATTCTCGGCGACTAAACACAAAG[T/A]AAGTTAATCCCAATTCAATTTCTGATAACAGTTTGTTAAAAGTTTTAGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/garj6hke