azin1a

Ensembl ID:
ENSDARG00000052789
ZFIN ID:
ZDB-GENE-050417-20
Description:
ornithine decarboxylase antizyme inhibitor [Source:RefSeq peptide;Acc:NP_001017568]
Human Orthologue:
AZIN1
Human Description:
antizyme inhibitor 1 [Source:HGNC Symbol;Acc:16432]
Mouse Orthologue:
Azin1
Mouse Description:
antizyme inhibitor 1 Gene [Source:MGI Symbol;Acc:MGI:1859169]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42831 Splice Site, Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa42831
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056101   None 198 None 7
ENSDART00000074706 Nonsense 303 454 9 12
ENSDART00000146607   None 73 None 4
ENSDART00000147236 Splice Site None 449 None 12

The following transcripts of ENSDARG00000052789 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 56319463)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 52830154
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCCGTGAATATAATCGATAAGAAGACGGTGGCTCGGGACTGCAGTGCA[C/T]AGCCACACGGTCAGTACTAGCTCAAATCAAGAATATGAGATACATTGTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link