azin1a

Ensembl ID:
ENSDARG00000052789
ZFIN ID:
ZDB-GENE-050417-20
Description:
ornithine decarboxylase antizyme inhibitor [Source:RefSeq peptide;Acc:NP_001017568]
Human Orthologue:
AZIN1
Human Description:
antizyme inhibitor 1 [Source:HGNC Symbol;Acc:16432]
Mouse Orthologue:
Azin1
Mouse Description:
antizyme inhibitor 1 Gene [Source:MGI Symbol;Acc:MGI:1859169]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4686 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4686
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056101 Nonsense 61 198 4 7
ENSDART00000074706 Nonsense 63 454 4 12
ENSDART00000146607 Nonsense 63 73 4 4
ENSDART00000147236 Nonsense 63 449 4 12

The following transcripts of ENSDARG00000052789 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 56328475)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTGGGGGTGATCGTGCAGCAGCAGGCTCGCTGGAGAAATAAAATGGAC[C/T]AAATTCGGCCTTTCTACACCGTTAAGAGCAACAGCAGCCCTGTAGTTGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/d68kgxsb