glrba

Ensembl ID:
ENSDARG00000052782
ZFIN ID:
ZDB-GENE-010410-2
Human Orthologue:
GLRB
Human Description:
glycine receptor, beta [Source:HGNC Symbol;Acc:4329]
Mouse Orthologue:
Glrb
Mouse Description:
glycine receptor, beta subunit Gene [Source:MGI Symbol;Acc:MGI:95751]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19479 Essential Splice Site Available for shipment Available now
sa11272 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19479
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102790 Essential Splice Site 249 400 7 10
Genomic Location (Zv9):
Chromosome 1 (position 20246646)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 20771057
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAAGAGGATATTAAATATGCAAACTGCACCAAGTTCTACCCTGGAACAG[G/A]TATGGATTGATGTAAATATATAAATACTTTGATATTTGCATTTATATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11272
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102790 Nonsense 369 400 10 10
Genomic Location (Zv9):
Chromosome 1 (position 20222074)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 20746485
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTGAACAGCCCCAAACGYATAGAGGCAGAGAAAATAAAGATGGCTGAG[A/T]AAGAGAAAGCCAGAGAAAAAGAGAACAAGACACCGGCTAAAACTAAYAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link