glrba

Ensembl ID:
ENSDARG00000052782
ZFIN ID:
ZDB-GENE-010410-2
Human Orthologue:
GLRB
Human Description:
glycine receptor, beta [Source:HGNC Symbol;Acc:4329]
Mouse Orthologue:
Glrb
Mouse Description:
glycine receptor, beta subunit Gene [Source:MGI Symbol;Acc:MGI:95751]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3344 Nonsense Mutation detected in F1 DNA During 2014
sa19479 Essential Splice Site Mutation detected in F1 DNA During 2014
sa11272 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa3344
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102790 Nonsense 157 400 5 10
Genomic Location:
Chromosome 1 (position 20255803)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGATCTGTTTTTTGCCAATGAAAAAAATGCAAACTTTCATGACGTYACA[C/T]AGGAAAACATACTGCTYTTCATCTTCCGCAATGGYGACGTCCTCATCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19479
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102790 Essential Splice Site 249 400 7 10
Genomic Location:
Chromosome 1 (position 20246646)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAAGAGGATATTAAATATGCAAACTGCACCAAGTTCTACCCTGGAACAG[G/A]TATGGATTGATGTAAATATATAAATACTTTGATATTTGCATTTATATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11272
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102790 Nonsense 369 400 10 10
Genomic Location:
Chromosome 1 (position 20222074)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTGAACAGCCCCAAACGYATAGAGGCAGAGAAAATAAAGATGGCTGAG[A/T]AAGAGAAAGCCAGAGAAAAAGAGAACAAGACACCGGCTAAAACTAAYAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4rxpdx1m