ENSDARG00000052772

Ensembl ID:
ENSDARG00000052772
Human Orthologue:
RETSAT
Human Description:
retinol saturase (all-trans-retinol 13,14-reductase) [Source:HGNC Symbol;Acc:25991]
Mouse Orthologue:
Retsat
Mouse Description:
retinol saturase (all trans retinol 13,14 reductase) Gene [Source:MGI Symbol;Acc:MGI:1914692]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21997 Nonsense Mutation detected in F1 DNA During 2014
sa18065 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21997
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074692 Nonsense 84 614 2 11
Genomic Location:
Chromosome 12 (position 3844110)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATAGGAAGTGGGATCGGAGGAATGACGGCTGCAGCCACAATGGCCAAAT[C/A]AGGGAAGAAAGTTCTGGTTTTGGAGCAACACGACGTGGCAGGAGGCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18065
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074692 Nonsense 476 614 9 11
Genomic Location:
Chromosome 12 (position 3833076)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTGAATTATGAATGGTTCGAGGACTGGAAGGACACGCGAGTGAGGAAA[C/T]GAGGAGACGATTATTTCAGCTATAAGCAGAGATTTGCAGACCAWATCTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/aztdqmje