glrbb

Ensembl ID:
ENSDARG00000052769
ZFIN ID:
ZDB-GENE-040801-106
Description:
glycine receptor subunit beta [Source:RefSeq peptide;Acc:NP_001003587]
Human Orthologue:
GLRB
Human Description:
glycine receptor, beta [Source:HGNC Symbol;Acc:4329]
Mouse Orthologue:
Glrb
Mouse Description:
glycine receptor, beta subunit Gene [Source:MGI Symbol;Acc:MGI:95751]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa193 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa193
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074685 Nonsense 234 494 7 10
ENSDART00000132907 Nonsense 242 451 7 9
Genomic Location (Zv9):
Chromosome 14 (position 36937992)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 35377319
KASP Assay ID:
554-2481.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGACCCCGTGCAGATGGATGAAATTGCTCTGCCTCAGTTTGATATTAAG[C/T]AAGAAGACATTGAATATGGCAACTGCACCAAGTACTACGCAGGGACAGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link