si:ch211-239f4.1

Ensembl ID:
ENSDARG00000052766
ZFIN ID:
ZDB-GENE-061207-24
Description:
Novel protein similar to human and mouse ecotropic viral integration site 5-like (EVI5L) [Source:Uni
Human Orthologue:
EVI5L
Human Description:
ecotropic viral integration site 5-like [Source:HGNC Symbol;Acc:30464]
Mouse Orthologue:
Evi5l
Mouse Description:
ecotropic viral integration site 5 like Gene [Source:MGI Symbol;Acc:MGI:2442167]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17572 Nonsense Available for shipment Available now
sa32739 Essential Splice Site Mutation detected in F1 DNA During 2017
sa12742 Nonsense Available for shipment Available now
sa15533 Essential Splice Site Available for shipment Available now
sa19554 Essential Splice Site Available for shipment Available now
sa17798 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17572
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074683 Nonsense 63 996 1 23
ENSDART00000125037 Nonsense 63 707 2 17
ENSDART00000125276 Nonsense 50 387 2 10
Genomic Location (Zv9):
Chromosome 1 (position 45691823)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44535042
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTCCCATGATGCCGCTCTSTCCGCCCCYGCCGCTTCCYCAGCTGACTCC[G/T]AAAACCTCAGTCCAGATGAGCTYGAGCTTYTGGCTAAACTGGARGAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32739
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074683 Essential Splice Site 144 996 2 23
ENSDART00000125037 Essential Splice Site 144 707 3 17
ENSDART00000125276 Essential Splice Site 131 387 3 10
Genomic Location (Zv9):
Chromosome 1 (position 45696154)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44539373
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTCAACGAGTGGGATGAGTGGAGACGAAAGAAGGACAAGCTTTTAAAG[G/T]TGATTACTTGGGCTGTCTTTAAGGGTTGAATTATATTATCGGAACATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12742
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074683 Nonsense 185 996 3 23
ENSDART00000125037 Nonsense 185 707 4 17
ENSDART00000125276 Nonsense 172 387 4 10
Genomic Location (Zv9):
Chromosome 1 (position 45698996)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44542215
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AWGCCTGTGAAGAATCARTATTCTGAACTCTKGAAGATGTCCTCGCCCTG[T/A]GAAAAACTYATACGCAGAGATATCGCCCGCACYTATCCCGAACATGACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15533
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074683 Essential Splice Site 219 996 3 23
ENSDART00000125037 Essential Splice Site 219 707 4 17
ENSDART00000125276 Essential Splice Site 206 387 4 10
Genomic Location (Zv9):
Chromosome 1 (position 45699099)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44542318
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAAAGGCCAGGACAGCCTGGGACAGGAAGTGCTGTTYAATGTCATGAAG[G/A]TGAGAAAGACAGAAACGGGTCATGACAGCAAGAGAGAGCAGCACAGGACW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19554
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074683 Essential Splice Site 244 996 4 23
ENSDART00000125037 Essential Splice Site 244 707 5 17
ENSDART00000125276 Essential Splice Site 231 387 5 10
Genomic Location (Zv9):
Chromosome 1 (position 45701896)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44545115
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTTATTGTCAGGGCAGCGCCTTCATCGTTGGATTGCTACTTATGCAGG[T/C]TTGCCTCTGCGTTTTGCTTATCATGATGAGCTAAAACAATGTCAAGAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17798
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074683 Nonsense 356 996 7 23
ENSDART00000125037 Nonsense 356 707 8 17
ENSDART00000125276 Nonsense 343 387 8 10
Genomic Location (Zv9):
Chromosome 1 (position 45704368)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44547587
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
WATTTCGAGTAGGAATAGCGATATTGCAGTACAACCAGACTGACCTCATA[C/T]AGCTAGACATGGAGGGAATGTCGCAGGTKGGAGCAAAAGCATCWCTGCTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link