gria2b

Ensembl ID:
ENSDARG00000052765
ZFIN ID:
ZDB-GENE-020125-4
Description:
glutamate receptor, ionotropic, AMPA 2b [Source:RefSeq peptide;Acc:NP_571970]
Human Orthologue:
GRIA2
Human Description:
glutamate receptor, ionotropic, AMPA 2 [Source:HGNC Symbol;Acc:4572]
Mouse Orthologue:
Gria2
Mouse Description:
glutamate receptor, ionotropic, AMPA2 (alpha 2) Gene [Source:MGI Symbol;Acc:MGI:95809]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22520 Nonsense Mutation detected in F1 DNA During 2014
sa1498 Splice Site, Nonsense Available for shipment Available now
sa10318 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22520
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064617 Nonsense 250 879 6 16
ENSDART00000074671 Nonsense 250 897 6 16

The following transcripts of ENSDARG00000052765 do not overlap with this mutation:

Genomic Location:
Chromosome 14 (position 37016425)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCCATTTCATGTTTTTAGGGTTTTGTGGATGGAGATCTTTCTAAAATC[C/T]AGTATGGTGGAGCGAATGTGTCAGGCTTTCAGATTGTGGATTTTGATGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1498
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064617 Splice Site, Nonsense 489 879 11 16
ENSDART00000074671 Splice Site, Nonsense 489 897 11 16

The following transcripts of ENSDARG00000052765 do not overlap with this mutation:

Genomic Location:
Chromosome 14 (position 37020387)
KASP Assay ID:
554-1423.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTAAAAATATAATTTAAGAATTAAACCGAAATTAAATCTCTCGTTTCAG[A/T]AAGCTGACATCGCAGTGGCTCCACTGACTATCACTTTAGTCCGAGAAGAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa10318
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064617 Nonsense 838 879 15 16
ENSDART00000074671 Nonsense 838 897 15 16

The following transcripts of ENSDARG00000052765 do not overlap with this mutation:

Genomic Location:
Chromosome 14 (position 37030569)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTGGCCATGCTGGTGGCCCTGGTCGAGTTCTGTTACAAGTCCCGAGCC[G/T]AGGCCAAGCGCATGAAGGTGGCAAAGAATGCACAGAATATTAATCCCACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fg7m3edv