gria2b

Ensembl ID:
ENSDARG00000052765
ZFIN ID:
ZDB-GENE-020125-4
Description:
glutamate receptor, ionotropic, AMPA 2b [Source:RefSeq peptide;Acc:NP_571970]
Human Orthologue:
GRIA2
Human Description:
glutamate receptor, ionotropic, AMPA 2 [Source:HGNC Symbol;Acc:4572]
Mouse Orthologue:
Gria2
Mouse Description:
glutamate receptor, ionotropic, AMPA2 (alpha 2) Gene [Source:MGI Symbol;Acc:MGI:95809]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22520 Nonsense Mutation detected in F1 DNA During 2016
sa35727 Nonsense Mutation detected in F1 DNA During 2016
sa1498 Splice Site, Nonsense Available for shipment Available now
sa39009 Essential Splice Site Mutation detected in F1 DNA During 2016
sa10318 Nonsense Available for shipment Available now
sa42424 Essential Splice Site, Missense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa22520
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064617 Nonsense 250 879 6 16
ENSDART00000074671 Nonsense 250 897 6 16

The following transcripts of ENSDARG00000052765 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 37016425)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 35455752
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCCATTTCATGTTTTTAGGGTTTTGTGGATGGAGATCTTTCTAAAATC[C/T]AGTATGGTGGAGCGAATGTGTCAGGCTTTCAGATTGTGGATTTTGATGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35727
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064617 Nonsense 377 879 8 16
ENSDART00000074671 Nonsense 377 897 8 16

The following transcripts of ENSDARG00000052765 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 37019760)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 35459087
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGACCAGTATGGAAAGAGAGTGAATTACACCGTCAATGTCATGGAATTG[A/T]AAAGCAACGGAGCAGTTAAGGTAAGACTCAGTCCTAATAATGCACTTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1498
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064617 Splice Site, Nonsense 489 879 11 16
ENSDART00000074671 Splice Site, Nonsense 489 897 11 16

The following transcripts of ENSDARG00000052765 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 37020387)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 35459714
KASP Assay ID:
554-1423.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTAAAAATATAATTTAAGAATTAAACCGAAATTAAATCTCTCGTTTCAG[A/T]AAGCTGACATCGCAGTGGCTCCACTGACTATCACTTTAGTCCGAGAAGAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa39009
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064617   None 879 None 16
ENSDART00000074671 Essential Splice Site 798 897 14 16

The following transcripts of ENSDARG00000052765 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 37026457)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 35465784
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGGTGGTACGACAAGGGAGAGTGCGGCAGCGGGGGAGGTGATTCCAAG[G/A]TCAGCCCCAGAGAGCAAAGTGATGGGTAACTCAATGCAACACTCAAGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10318
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064617 Nonsense 838 879 15 16
ENSDART00000074671 Nonsense 838 897 15 16

The following transcripts of ENSDARG00000052765 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 37030569)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 35469896
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTGGCCATGCTGGTGGCCCTGGTCGAGTTCTGTTACAAGTCCCGAGCC[G/T]AGGCCAAGCGCATGAAGGTGGCAAAGAATGCACAGAATATTAATCCCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42424
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064617 Missense 844 879 15 16
ENSDART00000074671 Essential Splice Site 843 897 15 16

The following transcripts of ENSDARG00000052765 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 37030587)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 35469914
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTGGTCGAGTTCTGTTACAAGTCCCGAGCCGAGGCCAAGCGCATGAAG[G/A]TGGCAAAGAATGCACAGAATATTAATCCCACTTCCTCGCAGAATTCACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link