chrnb3a

Ensembl ID:
ENSDARG00000052764
ZFIN ID:
ZDB-GENE-040108-1
Description:
cholinergic receptor, nicotinic, beta polypeptide 3a [Source:RefSeq peptide;Acc:NP_957514]
Human Orthologue:
CHRNB3
Human Description:
cholinergic receptor, nicotinic, beta 3 [Source:HGNC Symbol;Acc:1963]
Mouse Orthologue:
Chrnb3
Mouse Description:
cholinergic receptor, nicotinic, beta polypeptide 3 Gene [Source:MGI Symbol;Acc:MGI:106212]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39605 Nonsense Mutation detected in F1 DNA During 2016
sa12587 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39605
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074678 Nonsense 76 467 3 6
Genomic Location (Zv9):
Chromosome 1 (position 21167722)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 21702889
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATATTTATCTCTCTCTTTTTTATATTTCTTCCCCAGGATGAAAAAAAT[C/T]AACTGATGACCACAAATGTCTGGTTGTGGGAGGTAATACAAAGATAATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12587
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074678 Nonsense 179 467 5 6
Genomic Location (Zv9):
Chromosome 1 (position 21165948)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 21701115
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCCCTTTGACAGACAGAACTGCTCAATGAAGTTTGGATCATGGACATA[C/A]RATGGCACTATGGTGGATCTGACCCTTGTTGACGCTTACGTGGACCGTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Nicotine dependence: CHRNB3 is more strongly associated with Fagerström test for cigarette dependence-based nicotine dependence than cigarettes per day: phenotype definition changes genome-wide association studies results. (View Study)
  • Smoking behavior: Sequence variants at CHRNB3-CHRNA6 and CYP2A6 affect smoking behavior. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link